EMAIL THIS PAGE TO A FRIEND

HPRT1

hypoxanthine phosphoribosyltransferase 1

Synonyms: HGPRT HPRT
UniProtKB ID: P00492, A6NHF0, B2R8M9
Gene ID:
Human(3251) Summary: The protein encoded by this gene is a transferase, which catalyzes conversion of hypoxanthine to inosine monophosphate and guanine to guanosine monophosphate via transfer of the 5-phosphoribosyl group from 5-phosphoribosyl 1-pyrophosphate. This enzyme plays a central role in the generation of purine nucleotides through the purine salvage pathway. Mutations in this gene result in Lesch-Nyhan syndrome or gout.[provided by RefSeq, Jun 2009]
Rat(24465) hypoxanthine phosphoribosyltransferase 1
sheep(100188975) hypoxanthine phosphoribosyltransferase 1
Domestic Rabbit(100126071) hypoxanthine phosphoribosyltransferase 1
domestic guinea pig(100727355) hypoxanthine phosphoribosyltransferase 1
naked mole-rat(101714108) hypoxanthine phosphoribosyltransferase 1
Zebrafish(406259) hypoxanthine phosphoribosyltransferase 1
cow(281229) hypoxanthine phosphoribosyltransferase 1
Horse(100034149) hypoxanthine phosphoribosyltransferase 1
domestic cat(768284) hypoxanthine phosphoribosyltransferase 1
dog(442945) hypoxanthine phosphoribosyltransferase 1
chicken(395653) hypoxanthine phosphoribosyltransferase 1
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000194 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000194 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000194 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU078931 MISSION® esiRNA esiRNA human HPRT1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000194 siRNAs that have been validated in the lab human pricing
NM_012583 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000194 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00220178 validated 720
1 SASI_Hs01_00220177 validated 425
1 SASI_Hs01_00220176 validated 857
2 SASI_Hs01_00220179 predicted 551
3 SASI_Hs01_00220180 predicted 728
4 SASI_Hs01_00220181 predicted 374
5 SASI_Hs01_00220182 predicted 300
6 SASI_Hs01_00220183 predicted 845
7 SASI_Hs01_00220185 predicted 424
8 SASI_Hs02_00302046 predicted 209
9 SASI_Hs01_00220184 predicted 463
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012583 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00105963 predicted 818
2 SASI_Rn01_00105964 predicted 613
3 SASI_Rn01_00105965 predicted 669
4 SASI_Rn01_00105966 predicted 426
5 SASI_Rn01_00105967 predicted 325
6 SASI_Rn01_00105968 predicted 798
7 SASI_Rn02_00259722 predicted 192
8 SASI_Rn01_00105969 predicted 463
9 SASI_Rn01_00105970 predicted 273
10 SASI_Rn01_00105971 predicted 751
11 SASI_Rn01_00105972 predicted 441
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000194
VALIDATED
HPRT1 MISSION shRNA Bacterial Glycerol Stock
hypoxanthine phosphoribosyltransferase 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000299856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-478s21c1
Sequence:CCGGGCTATTGTAATGACCAGTCAACTCGAGTTGACTGGTCATTACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-784s21c1
Sequence:CCGGGTGTCATTAGTGAAACTGGAACTCGAGTTCCAGTTTCACTAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-693s21c1
Sequence:CCGGCCAGACTTTGTTGGATTTGAACTCGAGTTCAAATCCAACAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000299782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000194.2-210s21c1
Sequence:CCGGCCAGGTTATGACCTTGATTTACTCGAGTAAATCAAGGTCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-128s1c1
Sequence:CCGGCCAGGTTATGACCTTGATTTACTCGAGTAAATCAAGGTCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-611s1c1
Sequence:CCGGCCAGACTTTGTTGGATTTGAACTCGAGTTCAAATCCAACAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-159s1c1
Sequence:CCGGCTAATCATTATGCTGAGGATTCTCGAGAATCCTCAGCATAATGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-702s1c1
Sequence:CCGGGTGTCATTAGTGAAACTGGAACTCGAGTTCCAGTTTCACTAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000194
VALIDATED
HPRT1 MISSION shRNA shRNA Plasmid DNA
hypoxanthine phosphoribosyltransferase 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000299856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-478s21c1
Sequence:CCGGGCTATTGTAATGACCAGTCAACTCGAGTTGACTGGTCATTACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-784s21c1
Sequence:CCGGGTGTCATTAGTGAAACTGGAACTCGAGTTCCAGTTTCACTAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-693s21c1
Sequence:CCGGCCAGACTTTGTTGGATTTGAACTCGAGTTCAAATCCAACAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000299782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000194.2-210s21c1
Sequence:CCGGCCAGGTTATGACCTTGATTTACTCGAGTAAATCAAGGTCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-128s1c1
Sequence:CCGGCCAGGTTATGACCTTGATTTACTCGAGTAAATCAAGGTCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-611s1c1
Sequence:CCGGCCAGACTTTGTTGGATTTGAACTCGAGTTCAAATCCAACAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-159s1c1
Sequence:CCGGCTAATCATTATGCTGAGGATTCTCGAGAATCCTCAGCATAATGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-702s1c1
Sequence:CCGGGTGTCATTAGTGAAACTGGAACTCGAGTTCCAGTTTCACTAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000194
VALIDATED
HPRT1 MISSION shRNA Lentiviral Transduction Particles
hypoxanthine phosphoribosyltransferase 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000299856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-478s21c1
Sequence:CCGGGCTATTGTAATGACCAGTCAACTCGAGTTGACTGGTCATTACAATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299857    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-784s21c1
Sequence:CCGGGTGTCATTAGTGAAACTGGAACTCGAGTTCCAGTTTCACTAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299783    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_000194.2-693s21c1
Sequence:CCGGCCAGACTTTGTTGGATTTGAACTCGAGTTCAAATCCAACAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000299782    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000194.2-210s21c1
Sequence:CCGGCCAGGTTATGACCTTGATTTACTCGAGTAAATCAAGGTCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-128s1c1
Sequence:CCGGCCAGGTTATGACCTTGATTTACTCGAGTAAATCAAGGTCATAACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-611s1c1
Sequence:CCGGCCAGACTTTGTTGGATTTGAACTCGAGTTCAAATCCAACAAAGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-159s1c1
Sequence:CCGGCTAATCATTATGCTGAGGATTCTCGAGAATCCTCAGCATAATGATTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035053    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_000194.1-702s1c1
Sequence:CCGGGTGTCATTAGTGAAACTGGAACTCGAGTTCCAGTTTCACTAATGACACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks