EMAIL THIS PAGE TO A FRIEND

HRC

histidine rich calcium binding protein

UniProtKB ID: P23327, Q504Y6
Gene ID:
Human(3270) Summary: This gene encodes a luminal sarcoplasmic reticulum protein identified by its ability to bind low-density lipoprotein with high affinity. The protein interacts with the cytoplasmic domain of triadin, the main transmembrane protein of the junctional sarcoplasmic reticulum (SR) of skeletal muscle. The protein functions in the regulation of releasable calcium into the SR. [provided by RefSeq, Sep 2008]
Mouse(15464) histidine rich calcium binding protein
Rat(292905) histidine rich calcium binding protein
Zebrafish(553296) Hrc protein
cow(617610) histidine rich calcium binding protein
Horse(100049576) histidine rich calcium binding protein
domestic cat(101099673) histidine rich calcium binding protein
dog(484386) histidine rich calcium binding protein
sheep(101104597) histidine rich calcium binding protein
Domestic Rabbit(100009049) histidine rich calcium binding protein
domestic guinea pig(100726451) histidine rich calcium binding protein
naked mole-rat(101707934) histidine rich calcium binding protein
53 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010473 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010473 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010473 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002152 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002152 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002152 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU138591 MISSION® esiRNA esiRNA human HRC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002152 Rosetta Predictions human pricing
NM_181369 Rosetta Predictions rat pricing
NM_010473 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002152 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00157731 predicted 1343
2 SASI_Hs01_00157732 predicted 409
3 SASI_Hs01_00157734 predicted 1336
4 SASI_Hs01_00157736 predicted 1336
5 SASI_Hs01_00157737 predicted 531
6 SASI_Hs01_00157739 predicted 372
7 SASI_Hs01_00157740 predicted 1554
8 SASI_Hs02_00333340 predicted 377
9 SASI_Hs02_00333341 predicted 517
10 SASI_Hs01_00157733 predicted 467
11 SASI_Hs01_00157735 predicted 426
12 SASI_Hs01_00157738 predicted 1531
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181369 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00083712 predicted 1472
2 SASI_Rn01_00083713 predicted 191
3 SASI_Rn01_00083715 predicted 346
4 SASI_Rn01_00083716 predicted 222
5 SASI_Rn01_00083717 predicted 207
6 SASI_Rn01_00083718 predicted 1406
7 SASI_Rn01_00083719 predicted 1415
8 SASI_Rn01_00083720 predicted 1538
9 SASI_Rn01_00083721 predicted 212
10 SASI_Rn02_00269699 predicted 230
11 SASI_Rn01_00083714 predicted 316
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010473 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00128836 predicted 1415
2 SASI_Mm01_00128837 predicted 351
3 SASI_Mm01_00128838 predicted 1470
4 SASI_Mm01_00128841 predicted 1434
5 SASI_Mm02_00318679 predicted 305
6 SASI_Mm02_00318680 predicted 300
7 SASI_Mm01_00128845 predicted 423
8 SASI_Mm02_00318681 predicted 320
9 SASI_Mm02_00318682 predicted 222
10 SASI_Mm02_00318683 predicted 1426
11 SASI_Mm01_00128839 predicted 1483
12 SASI_Mm01_00128840 predicted 1482
13 SASI_Mm01_00128842 predicted 1429
14 SASI_Mm01_00128843 predicted 1446
15 SASI_Mm01_00128844 predicted 1438
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010473
HRC MISSION shRNA Bacterial Glycerol Stock
histidine rich calcium binding protein
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000120572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-1849s1c1
Sequence:CCGGCCTACTACCTTTCACCATTATCTCGAGATAATGGTGAAAGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-731s1c1
Sequence:CCGGGCTCACAGATATCAGGATCATCTCGAGATGATCCTGATATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-842s1c1
Sequence:CCGGTCTGGTGAATACAGACACCATCTCGAGATGGTGTCTGTATTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-1220s1c1
Sequence:CCGGGATGAGGCTGTATCCACTGAACTCGAGTTCAGTGGATACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000120575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-179s1c1
Sequence:CCGGGAGGACCTATCAACTGAGTTTCTCGAGAAACTCAGTTGATAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010473
HRC MISSION shRNA shRNA Plasmid DNA
histidine rich calcium binding protein
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000120572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-1849s1c1
Sequence:CCGGCCTACTACCTTTCACCATTATCTCGAGATAATGGTGAAAGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-731s1c1
Sequence:CCGGGCTCACAGATATCAGGATCATCTCGAGATGATCCTGATATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-842s1c1
Sequence:CCGGTCTGGTGAATACAGACACCATCTCGAGATGGTGTCTGTATTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-1220s1c1
Sequence:CCGGGATGAGGCTGTATCCACTGAACTCGAGTTCAGTGGATACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000120575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-179s1c1
Sequence:CCGGGAGGACCTATCAACTGAGTTTCTCGAGAAACTCAGTTGATAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010473
HRC MISSION shRNA Lentiviral Transduction Particles
histidine rich calcium binding protein
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000120572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-1849s1c1
Sequence:CCGGCCTACTACCTTTCACCATTATCTCGAGATAATGGTGAAAGGTAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120573    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-731s1c1
Sequence:CCGGGCTCACAGATATCAGGATCATCTCGAGATGATCCTGATATCTGTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120574    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-842s1c1
Sequence:CCGGTCTGGTGAATACAGACACCATCTCGAGATGGTGTCTGTATTCACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-1220s1c1
Sequence:CCGGGATGAGGCTGTATCCACTGAACTCGAGTTCAGTGGATACAGCCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000120575    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010473.1-179s1c1
Sequence:CCGGGAGGACCTATCAACTGAGTTTCTCGAGAAACTCAGTTGATAGGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002152
HRC MISSION shRNA Bacterial Glycerol Stock
histidine rich calcium binding protein
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-679s1c1
Sequence:CCGGCCAGTGAGCATCACCATCATACTCGAGTATGATGGTGATGCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-996s1c1
Sequence:CCGGCACGGGATTGAAGAGGATGAACTCGAGTTCATCCTCTTCAATCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-1383s1c1
Sequence:CCGGGACTTCCAAGATGAGTATAAACTCGAGTTTATACTCATCTTGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-394s1c1
Sequence:CCGGCCACAGAGAATGGGCATCATTCTCGAGAATGATGCCCATTCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-2193s1c1
Sequence:CCGGCCAGGAAGCTACGTTGACTATCTCGAGATAGTCAACGTAGCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002152.2-1339s21c1
Sequence:CCGGAGTCCAGTTCGGCCACTATGTCTCGAGACATAGTGGCCGAACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002152.2-1545s21c1
Sequence:CCGGGTCAAAGAGGGTCCATCAAAGCTCGAGCTTTGATGGACCCTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002152
HRC MISSION shRNA shRNA Plasmid DNA
histidine rich calcium binding protein
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-679s1c1
Sequence:CCGGCCAGTGAGCATCACCATCATACTCGAGTATGATGGTGATGCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-996s1c1
Sequence:CCGGCACGGGATTGAAGAGGATGAACTCGAGTTCATCCTCTTCAATCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-1383s1c1
Sequence:CCGGGACTTCCAAGATGAGTATAAACTCGAGTTTATACTCATCTTGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-394s1c1
Sequence:CCGGCCACAGAGAATGGGCATCATTCTCGAGAATGATGCCCATTCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-2193s1c1
Sequence:CCGGCCAGGAAGCTACGTTGACTATCTCGAGATAGTCAACGTAGCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002152.2-1339s21c1
Sequence:CCGGAGTCCAGTTCGGCCACTATGTCTCGAGACATAGTGGCCGAACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002152.2-1545s21c1
Sequence:CCGGGTCAAAGAGGGTCCATCAAAGCTCGAGCTTTGATGGACCCTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002152
HRC MISSION shRNA Lentiviral Transduction Particles
histidine rich calcium binding protein
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-679s1c1
Sequence:CCGGCCAGTGAGCATCACCATCATACTCGAGTATGATGGTGATGCTCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056116    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-996s1c1
Sequence:CCGGCACGGGATTGAAGAGGATGAACTCGAGTTCATCCTCTTCAATCCCGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056117    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-1383s1c1
Sequence:CCGGGACTTCCAAGATGAGTATAAACTCGAGTTTATACTCATCTTGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056113    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-394s1c1
Sequence:CCGGCCACAGAGAATGGGCATCATTCTCGAGAATGATGCCCATTCTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056114    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002152.1-2193s1c1
Sequence:CCGGCCAGGAAGCTACGTTGACTATCTCGAGATAGTCAACGTAGCTTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437447    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002152.2-1339s21c1
Sequence:CCGGAGTCCAGTTCGGCCACTATGTCTCGAGACATAGTGGCCGAACTGGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433550    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002152.2-1545s21c1
Sequence:CCGGGTCAAAGAGGGTCCATCAAAGCTCGAGCTTTGATGGACCCTCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks