EMAIL THIS PAGE TO A FRIEND

HRH2

histamine receptor H2

Synonyms: H2R
UniProtKB ID: P25021, B5BUP7, Q14464, Q7Z5R9
Gene ID:
Human(3274) Summary: Histamine is a ubiquitous messenger molecule released from mast cells, enterochromaffin-like cells, and neurons. Its various actions are mediated by histamine receptors H1, H2, H3 and H4. Histamine receptor H2 belongs to the family 1 of G protein-coupled receptors. It is an integral membrane protein and stimulates gastric acid secretion. It also regulates gastrointestinal motility and intestinal secretion and is thought to be involved in regulating cell growth and differentiation. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2008]
Mouse(15466) histamine receptor H2
Rat(25461) histamine receptor H 2
sheep(101103727) histamine receptor H2
sheep(443190) histamine receptor H2
Domestic Rabbit(100338726) histamine receptor H2
domestic guinea pig(100135540) histamine receptor H2
domestic guinea pig(100729734) histamine receptor H2
naked mole-rat(101718597) histamine receptor H2
Zebrafish(735303) histamine receptor H2
domestic cat(101084599) histamine receptor H2
dog(403812) histamine receptor H2
chicken(427635) histamine receptor H2
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Agonist

Product # Description Species Add to Cart
 
H7250 Histamine dihydrochloride ≥99% (TLC), powder human pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
M4910 1-Methylhistamine dihydrochloride ≥98% (TLC), powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008286 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008286 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008286 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_022304 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_022304 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_022304 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU033991 MISSION® esiRNA esiRNA targeting mouse Hrh2 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_022304 Rosetta Predictions human pricing
NM_012965 Rosetta Predictions rat pricing
NM_001010973 Rosetta Predictions mouse pricing
NM_008286 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_022304 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00355610 predicted 1015
2 SASI_Hs01_00125794 predicted 1042
3 SASI_Hs01_00125795 predicted 1085
4 SASI_Hs01_00125796 predicted 1118
5 SASI_Hs01_00125797 predicted 1157
6 SASI_Hs01_00125799 predicted 1216
7 SASI_Hs01_00125800 predicted 673
8 SASI_Hs01_00125801 predicted 922
9 SASI_Hs02_00355611 predicted 741
10 SASI_Hs02_00355612 predicted 1020
11 SASI_Hs01_00125798 predicted 1103
12 SASI_Hs01_00125802 predicted 1323
13 SASI_Hs01_00125803 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00108156 predicted 261
2 SASI_Rn01_00108157 predicted 596
3 SASI_Rn01_00108158 predicted 696
4 SASI_Rn01_00108159 predicted 220
5 SASI_Rn02_00260566 predicted 594
6 SASI_Rn01_00108160 predicted 513
7 SASI_Rn01_00108161 predicted 711
8 SASI_Rn01_00108162 predicted 442
9 SASI_Rn01_00108163 predicted 397
10 SASI_Rn02_00260567 predicted 434
11 SASI_Rn01_00108164 predicted 422
12 SASI_Rn01_00108165 predicted 705
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001010973 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106252 predicted 1315
2 SASI_Mm01_00106253 predicted 513
3 SASI_Mm01_00106254 predicted 902
4 SASI_Mm01_00106255 predicted 1133
5 SASI_Mm01_00106256 predicted 1095
6 SASI_Mm02_00286917 predicted 964
7 SASI_Mm01_00106257 predicted 532
8 SASI_Mm01_00106258 predicted 1253
9 SASI_Mm01_00106259 predicted 540
10 SASI_Mm01_00106260 predicted 522
11 SASI_Mm01_00106261 predicted 1036
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008286 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00108509 predicted 1314
2 SASI_Mm01_00108510 predicted 510
3 SASI_Mm01_00108511 predicted 900
4 SASI_Mm01_00108512 predicted 1131
5 SASI_Mm01_00108513 predicted 1099
6 SASI_Mm02_00313555 predicted 959
7 SASI_Mm01_00108514 predicted 530
8 SASI_Mm01_00108515 predicted 1252
9 SASI_Mm01_00108516 predicted 542
10 SASI_Mm01_00108517 predicted 524
11 SASI_Mm01_00108518 predicted 1034
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008286
HRH2 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000442938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008286.2-592s21c1
Sequence:CCGGTCATCACTGTTGCTGGCAATGCTCGAGCATTGCCAGCAACAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008286.2-655s21c1
Sequence:CCGGGTCTGACCAATTGCTTCATTGCTCGAGCAATGAAGCAATTGGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-595s1c1
Sequence:CCGGGTCACCTACTACAGAATCTTTCTCGAGAAAGATTCTGTAGTAGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-261s1c1
Sequence:CCGGCCAGGTCTTCTGCAACATCTACTCGAGTAGATGTTGCAGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-729s1c1
Sequence:CCGGCGTCTGCTGGTTTCCTTACTTCTCGAGAAGTAAGGAAACCAGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-416s1c1
Sequence:CCGGTGGTCTTTATTTGGGTCATTTCTCGAGAAATGACCCAAATAAAGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-919s1c1
Sequence:CCGGGCAAGCCACAACTCTCACAAACTCGAGTTTGTGAGAGTTGTGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008286
HRH2 MISSION shRNA shRNA Plasmid DNA
histamine receptor H2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000442938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008286.2-592s21c1
Sequence:CCGGTCATCACTGTTGCTGGCAATGCTCGAGCATTGCCAGCAACAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008286.2-655s21c1
Sequence:CCGGGTCTGACCAATTGCTTCATTGCTCGAGCAATGAAGCAATTGGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-595s1c1
Sequence:CCGGGTCACCTACTACAGAATCTTTCTCGAGAAAGATTCTGTAGTAGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-261s1c1
Sequence:CCGGCCAGGTCTTCTGCAACATCTACTCGAGTAGATGTTGCAGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-729s1c1
Sequence:CCGGCGTCTGCTGGTTTCCTTACTTCTCGAGAAGTAAGGAAACCAGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-416s1c1
Sequence:CCGGTGGTCTTTATTTGGGTCATTTCTCGAGAAATGACCCAAATAAAGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-919s1c1
Sequence:CCGGGCAAGCCACAACTCTCACAAACTCGAGTTTGTGAGAGTTGTGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008286
HRH2 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000442938    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008286.2-592s21c1
Sequence:CCGGTCATCACTGTTGCTGGCAATGCTCGAGCATTGCCAGCAACAGTGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441381    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008286.2-655s21c1
Sequence:CCGGGTCTGACCAATTGCTTCATTGCTCGAGCAATGAAGCAATTGGTCAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-595s1c1
Sequence:CCGGGTCACCTACTACAGAATCTTTCTCGAGAAAGATTCTGTAGTAGGTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-261s1c1
Sequence:CCGGCCAGGTCTTCTGCAACATCTACTCGAGTAGATGTTGCAGAAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027862    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-729s1c1
Sequence:CCGGCGTCTGCTGGTTTCCTTACTTCTCGAGAAGTAAGGAAACCAGCAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027856    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-416s1c1
Sequence:CCGGTGGTCTTTATTTGGGTCATTTCTCGAGAAATGACCCAAATAAAGACCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008286.1-919s1c1
Sequence:CCGGGCAAGCCACAACTCTCACAAACTCGAGTTTGTGAGAGTTGTGGCTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_022304
HRH2 MISSION shRNA Bacterial Glycerol Stock
histamine receptor H2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2262s21c1
Sequence:CCGGGACCAGCAAGGGCAATCATACCTCGAGGTATGATTGCCCTTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2835s21c1
Sequence:CCGGGGGAGCCACAGACAGGTAATACTCGAGTATTACCTGTCTGTGGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2405s21c1
Sequence:CCGGATCAGGCCAAGAGGATCAATCCTCGAGGATTGATCCTCTTGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022304.1-1651s1c1
Sequence:CCGGGCTACTGATGGGAATGATTAACTCGAGTTAATCATTCCCATCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-1162s1c1
Sequence:CCGGGCCAAGAGGATCAATCACATTCTCGAGAATGTGATTGATCCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-672s1c1
Sequence:CCGGCCGCAACCTGACCAATTGTTTCTCGAGAAACAATTGGTCAGGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-1315s1c1
Sequence:CCGGGCCATCAATGAGGTGTTAGAACTCGAGTTCTAACACCTCATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-931s1c1
Sequence:CCGGGCCATCTCTCTGGTCTTAATTCTCGAGAATTAAGACCAGAGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_022304
HRH2 MISSION shRNA shRNA Plasmid DNA
histamine receptor H2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2262s21c1
Sequence:CCGGGACCAGCAAGGGCAATCATACCTCGAGGTATGATTGCCCTTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2835s21c1
Sequence:CCGGGGGAGCCACAGACAGGTAATACTCGAGTATTACCTGTCTGTGGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2405s21c1
Sequence:CCGGATCAGGCCAAGAGGATCAATCCTCGAGGATTGATCCTCTTGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022304.1-1651s1c1
Sequence:CCGGGCTACTGATGGGAATGATTAACTCGAGTTAATCATTCCCATCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-1162s1c1
Sequence:CCGGGCCAAGAGGATCAATCACATTCTCGAGAATGTGATTGATCCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-672s1c1
Sequence:CCGGCCGCAACCTGACCAATTGTTTCTCGAGAAACAATTGGTCAGGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-1315s1c1
Sequence:CCGGGCCATCAATGAGGTGTTAGAACTCGAGTTCTAACACCTCATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-931s1c1
Sequence:CCGGGCCATCTCTCTGGTCTTAATTCTCGAGAATTAAGACCAGAGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_022304
HRH2 MISSION shRNA Lentiviral Transduction Particles
histamine receptor H2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378363    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2262s21c1
Sequence:CCGGGACCAGCAAGGGCAATCATACCTCGAGGTATGATTGCCCTTGCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2835s21c1
Sequence:CCGGGGGAGCCACAGACAGGTAATACTCGAGTATTACCTGTCTGTGGCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378345    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_022304.2-2405s21c1
Sequence:CCGGATCAGGCCAAGAGGATCAATCCTCGAGGATTGATCCTCTTGGCCTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011676    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_022304.1-1651s1c1
Sequence:CCGGGCTACTGATGGGAATGATTAACTCGAGTTAATCATTCCCATCAGTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-1162s1c1
Sequence:CCGGGCCAAGAGGATCAATCACATTCTCGAGAATGTGATTGATCCTCTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-672s1c1
Sequence:CCGGCCGCAACCTGACCAATTGTTTCTCGAGAAACAATTGGTCAGGTTGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-1315s1c1
Sequence:CCGGGCCATCAATGAGGTGTTAGAACTCGAGTTCTAACACCTCATTGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009069    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_022304.1-931s1c1
Sequence:CCGGGCCATCTCTCTGGTCTTAATTCTCGAGAATTAAGACCAGAGAGATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks