EMAIL THIS PAGE TO A FRIEND

HS3ST3A1

heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1

Synonyms: 30ST3A1 3OST3A1
UniProtKB ID: Q9Y663, A8K7N2
Gene ID:
Human(9955) Summary: Heparan sulfate biosynthetic enzymes are key components in generating a myriad of distinct heparan sulfate fine structures that carry out multiple biologic activities. The enzyme encoded by this gene is a member of the heparan sulfate biosynthetic enzyme family. It is a type II integral membrane protein and possesses heparan sulfate glucosaminyl 3-O-sulfotransferase activity. The sulfotransferase domain of this enzyme is highly similar to the same domain of heparan sulfate D-glucosaminyl 3-O-sulfotransferase 3A1, and these two enzymes sulfate an identical disaccharide. This gene is widely expressed, with the most abundant expression in liver and placenta. [provided by RefSeq, Jul 2008]
Mouse(15478) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Rat(363618) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
sheep(101105173) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
domestic guinea pig(100724360) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
naked mole-rat(101730064) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
chicken(769490) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
cow(521959) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
domestic cat(101087432) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
dog(489512) heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006042 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006042 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006042 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178870 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178870 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178870 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006042 Rosetta Predictions human pricing
XM_001078445 Rosetta Predictions rat pricing
XM_343911 Rosetta Predictions rat pricing
NM_178870 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006042 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013241 predicted 1588
2 SASI_Hs01_00013242 predicted 2270
3 SASI_Hs01_00013243 predicted 1478
4 SASI_Hs01_00013244 predicted 851
5 SASI_Hs01_00013245 predicted 2273
6 SASI_Hs01_00013246 predicted 858
7 SASI_Hs01_00013247 predicted 1592
8 SASI_Hs01_00013248 predicted 1565
9 SASI_Hs01_00013249 predicted 1643
10 SASI_Hs02_00340788 predicted 1383
11 SASI_Hs01_00013250 predicted 1785
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078445 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00360786 predicted 1023
2 SASI_Rn02_00360787 predicted 1241
3 SASI_Rn02_00360788 predicted 330
4 SASI_Rn02_00360789 predicted 643
5 SASI_Rn02_00360790 predicted 1368
6 SASI_Rn02_00360791 predicted 337
7 SASI_Rn02_00360792 predicted 1463
8 SASI_Rn02_00360793 predicted 1326
9 SASI_Rn02_00360794 predicted 1352
10 SASI_Rn02_00360795 predicted 1414
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343911 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00396555 predicted 683
2 SASI_Rn02_00396556 predicted 326
3 SASI_Rn02_00396557 predicted 337
4 SASI_Rn02_00396558 predicted 652
5 SASI_Rn02_00396559 predicted 709
6 SASI_Rn02_00396560 predicted 339
7 SASI_Rn02_00396561 predicted 885
8 SASI_Rn02_00396562 predicted 337
9 SASI_Rn02_00396563 predicted 700
10 SASI_Rn02_00396564 predicted 692
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178870 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00201818 predicted 2239
2 SASI_Mm01_00201819 predicted 2283
3 SASI_Mm01_00201820 predicted 2357
4 SASI_Mm01_00201821 predicted 2294
5 SASI_Mm01_00201822 predicted 2397
6 SASI_Mm02_00349454 predicted 1284
7 SASI_Mm01_00201823 predicted 780
8 SASI_Mm01_00201824 predicted 2356
9 SASI_Mm01_00201825 predicted 832
10 SASI_Mm01_00201826 predicted 2284
11 SASI_Mm01_00201827 predicted 831
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006042
HS3ST3A1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006042.1-871s21c1
Sequence:CCGGTTCTTGCTGATGCTCTGCTCCCTCGAGGGAGCAGAGCATCAGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006042.1-2285s21c1
Sequence:CCGGTAAGCATCAGTTGTCATTAAACTCGAGTTTAATGACAACTGATGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-861s1c1
Sequence:CCGGCTTCCGGAAGTTCTTGCTGATCTCGAGATCAGCAAGAACTTCCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-897s1c1
Sequence:CCGGCACGTCCCTTTACGTCTTCTACTCGAGTAGAAGACGTAAAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-1968s1c1
Sequence:CCGGCAACCTCAAGTTCTACCAGATCTCGAGATCTGGTAGAACTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-888s1c1
Sequence:CCGGCTCCCTGCTCACGTCCCTTTACTCGAGTAAAGGGACGTGAGCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-903s1c1
Sequence:CCGGCCTTTACGTCTTCTACTGCCTCTCGAGAGGCAGTAGAAGACGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006042
HS3ST3A1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006042.1-871s21c1
Sequence:CCGGTTCTTGCTGATGCTCTGCTCCCTCGAGGGAGCAGAGCATCAGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006042.1-2285s21c1
Sequence:CCGGTAAGCATCAGTTGTCATTAAACTCGAGTTTAATGACAACTGATGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-861s1c1
Sequence:CCGGCTTCCGGAAGTTCTTGCTGATCTCGAGATCAGCAAGAACTTCCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-897s1c1
Sequence:CCGGCACGTCCCTTTACGTCTTCTACTCGAGTAGAAGACGTAAAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-1968s1c1
Sequence:CCGGCAACCTCAAGTTCTACCAGATCTCGAGATCTGGTAGAACTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-888s1c1
Sequence:CCGGCTCCCTGCTCACGTCCCTTTACTCGAGTAAAGGGACGTGAGCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-903s1c1
Sequence:CCGGCCTTTACGTCTTCTACTGCCTCTCGAGAGGCAGTAGAAGACGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006042
HS3ST3A1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445792    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006042.1-871s21c1
Sequence:CCGGTTCTTGCTGATGCTCTGCTCCCTCGAGGGAGCAGAGCATCAGCAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427687    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006042.1-2285s21c1
Sequence:CCGGTAAGCATCAGTTGTCATTAAACTCGAGTTTAATGACAACTGATGCTTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-861s1c1
Sequence:CCGGCTTCCGGAAGTTCTTGCTGATCTCGAGATCAGCAAGAACTTCCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-897s1c1
Sequence:CCGGCACGTCCCTTTACGTCTTCTACTCGAGTAGAAGACGTAAAGGGACGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035838    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-1968s1c1
Sequence:CCGGCAACCTCAAGTTCTACCAGATCTCGAGATCTGGTAGAACTTGAGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-888s1c1
Sequence:CCGGCTCCCTGCTCACGTCCCTTTACTCGAGTAAAGGGACGTGAGCAGGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006042.1-903s1c1
Sequence:CCGGCCTTTACGTCTTCTACTGCCTCTCGAGAGGCAGTAGAAGACGTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178870
HS3ST3A1 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178870.2-2645s1c1
Sequence:CCGGGCCTCATTACAAAGCTGTATTCTCGAGAATACAGCTTTGTAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1897s1c1
Sequence:CCGGCGACTTTGGCTGGGATGGATACTCGAGTATCCATCCCAGCCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-835s1c1
Sequence:CCGGCACTTCCCTCTACGTCTTCTACTCGAGTAGAAGACGTAGAGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1282s1c1
Sequence:CCGGCCTCGCCTGGTACCGGGATTTCTCGAGAAATCCCGGTACCAGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1117s1c1
Sequence:CCGGCCTGGCCTTACTTCTGGACGACTCGAGTCGTCCAGAAGTAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178870
HS3ST3A1 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178870.2-2645s1c1
Sequence:CCGGGCCTCATTACAAAGCTGTATTCTCGAGAATACAGCTTTGTAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1897s1c1
Sequence:CCGGCGACTTTGGCTGGGATGGATACTCGAGTATCCATCCCAGCCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-835s1c1
Sequence:CCGGCACTTCCCTCTACGTCTTCTACTCGAGTAGAAGACGTAGAGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1282s1c1
Sequence:CCGGCCTCGCCTGGTACCGGGATTTCTCGAGAAATCCCGGTACCAGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1117s1c1
Sequence:CCGGCCTGGCCTTACTTCTGGACGACTCGAGTCGTCCAGAAGTAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178870
HS3ST3A1 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098085    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178870.2-2645s1c1
Sequence:CCGGGCCTCATTACAAAGCTGTATTCTCGAGAATACAGCTTTGTAATGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1897s1c1
Sequence:CCGGCGACTTTGGCTGGGATGGATACTCGAGTATCCATCCCAGCCAAAGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-835s1c1
Sequence:CCGGCACTTCCCTCTACGTCTTCTACTCGAGTAGAAGACGTAGAGGGAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098088    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1282s1c1
Sequence:CCGGCCTCGCCTGGTACCGGGATTTCTCGAGAAATCCCGGTACCAGGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178870.2-1117s1c1
Sequence:CCGGCCTGGCCTTACTTCTGGACGACTCGAGTCGTCCAGAAGTAAGGCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks