EMAIL THIS PAGE TO A FRIEND

HS3ST4

heparan sulfate (glucosamine) 3-O-sulfotransferase 4

Synonyms: 3-OST-4 30ST4 3OST4 h3-OST-4
UniProtKB ID: Q9Y661, Q5QI42, Q8NDC2
Gene ID:
Human(9951) Summary: This gene encodes the enzyme heparan sulfate D-glucosaminyl 3-O-sulfotransferase 4. This enzyme generates 3-O-sulfated glucosaminyl residues in heparan sulfate. Cell surface heparan sulfate is used as a receptor by herpes simplex virus type 1 (HSV-1), and expression of this gene is thought to play a role in HSV-1 pathogenesis. [provided by RefSeq, Jul 2008]
Mouse(628779) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
Zebrafish(563570) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
domestic cat(101087442) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
cow(100296463) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
Horse(100067117) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
dog(489960) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
chicken(427674) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
sheep(101119692) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
domestic guinea pig(100720750) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
naked mole-rat(101701411) heparan sulfate (glucosamine) 3-O-sulfotransferase 4
134 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1508 Human HS3ST4 ELISA for serum, plasma and cell culture supernatants human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006040 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006040 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006040 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006040 Rosetta Predictions human pricing
XM_893564 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006040 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00340785 predicted 1173
2 SASI_Hs01_00233631 predicted 2017
3 SASI_Hs01_00233633 predicted 1138
4 SASI_Hs01_00233634 predicted 2053
5 SASI_Hs01_00233635 predicted 1441
6 SASI_Hs01_00233636 predicted 1710
7 SASI_Hs02_00340786 predicted 1320
8 SASI_Hs01_00233632 predicted 1512
9 SASI_Hs01_00233639 predicted 1360
10 SASI_Hs01_00233640 predicted 1648
11 SASI_Hs01_00233637 predicted 1180
12 SASI_Hs01_00233638 predicted 1527
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_893564 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00280927 predicted 816
2 SASI_Mm01_00280928 predicted 1036
3 SASI_Mm01_00280929 predicted 720
4 SASI_Mm01_00280930 predicted 964
5 SASI_Mm01_00280932 predicted 810
6 SASI_Mm02_00429351 predicted 962
7 SASI_Mm01_00280933 predicted 1038
8 SASI_Mm01_00280934 predicted 967
9 SASI_Mm01_00280936 predicted 657
10 SASI_Mm02_00429352 predicted 846
11 SASI_Mm01_00280931 predicted 270
12 SASI_Mm01_00280935 predicted 1997
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006040
HS3ST4 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate (glucosamine) 3-O-sulfotransferase 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000441883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006040.2-1141s21c1
Sequence:CCGGAGACTTTGGATGGGCAAATAACTCGAGTTATTTGCCCATCCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000440025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006040.2-2072s21c1
Sequence:CCGGTGTCAGAGACAGTGCTATTAACTCGAGTTAATAGCACTGTCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006040.1-3004s1c1
Sequence:CCGGCCCATCAGTTTGATTCAATTACTCGAGTAATTGAATCAAACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1221s1c1
Sequence:CCGGGCCAAGGACATCAAACTGATTCTCGAGAATCAGTTTGATGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1516s1c1
Sequence:CCGGGCCTCAAACGTGTTGTGACTACTCGAGTAGTCACAACACGTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1664s1c1
Sequence:CCGGCCACAGACTGAGGAAATTCTACTCGAGTAGAATTTCCTCAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1173s1c1
Sequence:CCGGCCAAGTTACTTTGTGACAAATCTCGAGATTTGTCACAAAGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006040
HS3ST4 MISSION shRNA shRNA Plasmid DNA
heparan sulfate (glucosamine) 3-O-sulfotransferase 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000441883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006040.2-1141s21c1
Sequence:CCGGAGACTTTGGATGGGCAAATAACTCGAGTTATTTGCCCATCCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000440025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006040.2-2072s21c1
Sequence:CCGGTGTCAGAGACAGTGCTATTAACTCGAGTTAATAGCACTGTCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006040.1-3004s1c1
Sequence:CCGGCCCATCAGTTTGATTCAATTACTCGAGTAATTGAATCAAACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1221s1c1
Sequence:CCGGGCCAAGGACATCAAACTGATTCTCGAGAATCAGTTTGATGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1516s1c1
Sequence:CCGGGCCTCAAACGTGTTGTGACTACTCGAGTAGTCACAACACGTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1664s1c1
Sequence:CCGGCCACAGACTGAGGAAATTCTACTCGAGTAGAATTTCCTCAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1173s1c1
Sequence:CCGGCCAAGTTACTTTGTGACAAATCTCGAGATTTGTCACAAAGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006040
HS3ST4 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate (glucosamine) 3-O-sulfotransferase 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000441883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006040.2-1141s21c1
Sequence:CCGGAGACTTTGGATGGGCAAATAACTCGAGTTATTTGCCCATCCAAAGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000440025    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006040.2-2072s21c1
Sequence:CCGGTGTCAGAGACAGTGCTATTAACTCGAGTTAATAGCACTGTCTCTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035794    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006040.1-3004s1c1
Sequence:CCGGCCCATCAGTTTGATTCAATTACTCGAGTAATTGAATCAAACTGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1221s1c1
Sequence:CCGGGCCAAGGACATCAAACTGATTCTCGAGAATCAGTTTGATGTCCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035798    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1516s1c1
Sequence:CCGGGCCTCAAACGTGTTGTGACTACTCGAGTAGTCACAACACGTTTGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035797    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1664s1c1
Sequence:CCGGCCACAGACTGAGGAAATTCTACTCGAGTAGAATTTCCTCAGTCTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035795    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006040.1-1173s1c1
Sequence:CCGGCCAAGTTACTTTGTGACAAATCTCGAGATTTGTCACAAAGTAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks