EMAIL THIS PAGE TO A FRIEND

HSD17B13

hydroxysteroid (17-beta) dehydrogenase 13

Synonyms: NIIL497 SCDR9 SDR16C3
UniProtKB ID: Q7Z5P4, A8K9R9, Q2M1L5, Q86W22, Q86W23
Gene ID:
Mouse(243168) hydroxysteroid (17-beta) dehydrogenase 13
Rat(305150) hydroxysteroid (17-beta) dehydrogenase 13
dog(478468) hydroxysteroid (17-beta) dehydrogenase 13
domestic cat(101099712) hydroxysteroid (17-beta) dehydrogenase 13
cow(618192) hydroxysteroid (17-beta) dehydrogenase 13
sheep(101122359) hydroxysteroid (17-beta) dehydrogenase 13
domestic guinea pig(100712741) hydroxysteroid (17-beta) dehydrogenase 13
naked mole-rat(101721489) hydroxysteroid (17-beta) dehydrogenase 13
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178135 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178135 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178135 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_198030 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198030 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198030 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060061 MISSION® esiRNA esiRNA human HSD17B13 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178135 Rosetta Predictions human pricing
NM_001009684 Rosetta Predictions rat pricing
XM_001065370 Rosetta Predictions rat pricing
NM_198030 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178135 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00136794 predicted 644
2 SASI_Hs01_00136795 predicted 470
3 SASI_Hs02_00369541 predicted 339
4 SASI_Hs01_00136796 predicted 964
5 SASI_Hs01_00136797 predicted 965
6 SASI_Hs01_00136798 predicted 782
7 SASI_Hs01_00136800 predicted 788
8 SASI_Hs02_00369542 predicted 376
9 SASI_Hs01_00136801 predicted 772
10 SASI_Hs01_00136802 predicted 728
11 SASI_Hs01_00136799 predicted 512
12 SASI_Hs01_00136803 predicted 969
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009684 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199736 predicted 398
2 SASI_Rn01_00034565 predicted 243
3 SASI_Rn01_00034566 predicted 1047
4 SASI_Rn01_00034568 predicted 865
5 SASI_Rn01_00034569 predicted 837
6 SASI_Rn01_00034570 predicted 367
7 SASI_Rn01_00034571 predicted 772
8 SASI_Rn01_00034572 predicted 545
9 SASI_Rn02_00199737 predicted 726
10 SASI_Rn01_00034573 predicted 843
11 SASI_Rn01_00034564 predicted 911
12 SASI_Rn01_00034567 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001065370 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00313897 predicted 476
2 SASI_Rn02_00313898 predicted 405
3 SASI_Rn02_00313899 predicted 247
4 SASI_Rn02_00313900 predicted 1061
5 SASI_Rn02_00313901 predicted 217
6 SASI_Rn02_00313902 predicted 967
7 SASI_Rn02_00313903 predicted 988
8 SASI_Rn02_00313904 predicted 495
9 SASI_Rn02_00313905 predicted 284
10 SASI_Rn02_00313906 predicted 327
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198030 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350777 predicted 818
2 SASI_Mm01_00067294 predicted 540
3 SASI_Mm01_00067295 predicted 466
4 SASI_Mm01_00067296 predicted 380
5 SASI_Mm01_00067297 predicted 781
6 SASI_Mm01_00067300 predicted 727
7 SASI_Mm01_00067302 predicted 701
8 SASI_Mm01_00067303 predicted 313
9 SASI_Mm02_00350778 predicted 413
10 SASI_Mm02_00350779 predicted 745
11 SASI_Mm01_00067298 predicted 208
12 SASI_Mm01_00067299 predicted 356
13 SASI_Mm01_00067301 predicted 941
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178135
HSD17B13 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 13
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000425121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1424s21c1
Sequence:CCGGTATCTCAACCTGGACATATTTCTCGAGAAATATGTCCAGGTTGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1022s21c1
Sequence:CCGGTCAATGCTGCAAAGCTTTATTCTCGAGAATAAAGCTTTGCAGCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1096s21c1
Sequence:CCGGAGTCAAACGAACAAGATTAATCTCGAGATTAATCTTGTTCGTTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-594s1c1
Sequence:CCGGCCCATATTGTTCCAGCAAATTCTCGAGAATTTGCTGGAACAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-734s1c1
Sequence:CCGGGCACAAGATTATGGCCTGTATCTCGAGATACAGGCCATAATCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-382s1c1
Sequence:CCGGGATGTAACAATCGTGGTGAATCTCGAGATTCACCACGATTGTTACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-72s1c1
Sequence:CCGGGCTTCTGATCACCATCATCTACTCGAGTAGATGATGGTGATCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000028059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-514s1c1
Sequence:CCGGCCATCGATGATGGAGAGAAATCTCGAGATTTCTCTCCATCATCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178135
HSD17B13 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 13
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000425121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1424s21c1
Sequence:CCGGTATCTCAACCTGGACATATTTCTCGAGAAATATGTCCAGGTTGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1022s21c1
Sequence:CCGGTCAATGCTGCAAAGCTTTATTCTCGAGAATAAAGCTTTGCAGCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1096s21c1
Sequence:CCGGAGTCAAACGAACAAGATTAATCTCGAGATTAATCTTGTTCGTTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-594s1c1
Sequence:CCGGCCCATATTGTTCCAGCAAATTCTCGAGAATTTGCTGGAACAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-734s1c1
Sequence:CCGGGCACAAGATTATGGCCTGTATCTCGAGATACAGGCCATAATCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-382s1c1
Sequence:CCGGGATGTAACAATCGTGGTGAATCTCGAGATTCACCACGATTGTTACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-72s1c1
Sequence:CCGGGCTTCTGATCACCATCATCTACTCGAGTAGATGATGGTGATCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000028059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-514s1c1
Sequence:CCGGCCATCGATGATGGAGAGAAATCTCGAGATTTCTCTCCATCATCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178135
HSD17B13 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 13
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000425121    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1424s21c1
Sequence:CCGGTATCTCAACCTGGACATATTTCTCGAGAAATATGTCCAGGTTGAGATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418558    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1022s21c1
Sequence:CCGGTCAATGCTGCAAAGCTTTATTCTCGAGAATAAAGCTTTGCAGCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413485    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178135.3-1096s21c1
Sequence:CCGGAGTCAAACGAACAAGATTAATCTCGAGATTAATCTTGTTCGTTTGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028115    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-594s1c1
Sequence:CCGGCCCATATTGTTCCAGCAAATTCTCGAGAATTTGCTGGAACAATATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028050    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-734s1c1
Sequence:CCGGGCACAAGATTATGGCCTGTATCTCGAGATACAGGCCATAATCTTGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028042    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-382s1c1
Sequence:CCGGGATGTAACAATCGTGGTGAATCTCGAGATTCACCACGATTGTTACATCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-72s1c1
Sequence:CCGGGCTTCTGATCACCATCATCTACTCGAGTAGATGATGGTGATCAGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000028059    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178135.2-514s1c1
Sequence:CCGGCCATCGATGATGGAGAGAAATCTCGAGATTTCTCTCCATCATCGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198030
HSD17B13 MISSION shRNA Bacterial Glycerol Stock
hydroxysteroid (17-beta) dehydrogenase 13
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-462s1c1
Sequence:CCGGCCAAGACCTTTGAGGTCAATACTCGAGTATTGACCTCAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-823s1c1
Sequence:CCGGCGTTCCATCCTATATCAATATCTCGAGATATTGATATAGGATGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-752s1c1
Sequence:CCGGCCTGTATTAGAGCCGGAAGAACTCGAGTTCTTCCGGCTCTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-103s1c1
Sequence:CCGGCCTGGAGTCACTGGTAAAGTTCTCGAGAACTTTACCAGTGACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-577s1c1
Sequence:CCGGCGGAGTGATTCCTTATCTCATCTCGAGATGAGATAAGGAATCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198030
HSD17B13 MISSION shRNA shRNA Plasmid DNA
hydroxysteroid (17-beta) dehydrogenase 13
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-462s1c1
Sequence:CCGGCCAAGACCTTTGAGGTCAATACTCGAGTATTGACCTCAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-823s1c1
Sequence:CCGGCGTTCCATCCTATATCAATATCTCGAGATATTGATATAGGATGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-752s1c1
Sequence:CCGGCCTGTATTAGAGCCGGAAGAACTCGAGTTCTTCCGGCTCTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-103s1c1
Sequence:CCGGCCTGGAGTCACTGGTAAAGTTCTCGAGAACTTTACCAGTGACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-577s1c1
Sequence:CCGGCGGAGTGATTCCTTATCTCATCTCGAGATGAGATAAGGAATCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198030
HSD17B13 MISSION shRNA Lentiviral Transduction Particles
hydroxysteroid (17-beta) dehydrogenase 13
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041333    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-462s1c1
Sequence:CCGGCCAAGACCTTTGAGGTCAATACTCGAGTATTGACCTCAAAGGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-823s1c1
Sequence:CCGGCGTTCCATCCTATATCAATATCTCGAGATATTGATATAGGATGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041336    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-752s1c1
Sequence:CCGGCCTGTATTAGAGCCGGAAGAACTCGAGTTCTTCCGGCTCTAATACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041337    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-103s1c1
Sequence:CCGGCCTGGAGTCACTGGTAAAGTTCTCGAGAACTTTACCAGTGACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041334    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198030.1-577s1c1
Sequence:CCGGCGGAGTGATTCCTTATCTCATCTCGAGATGAGATAAGGAATCACTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks