EMAIL THIS PAGE TO A FRIEND

HSD3B2

hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2

Synonyms: HSD3B HSDB SDR11E2
Gene ID:
Human(3284) Summary: The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Mouse(15493) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
chicken(396015) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
dog(483146) hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Gene Class: Dehydrogenase
37 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153193 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153193 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153193 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000198 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000198 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000198 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU220251 MISSION® esiRNA esiRNA targeting human HSD3B2 human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000198 Rosetta Predictions human pricing
NM_153193 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000198 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00019863 predicted 667
2 SASI_Hs01_00019864 predicted 641
3 SASI_Hs02_00302065 predicted 1289
4 SASI_Hs01_00019867 predicted 639
5 SASI_Hs01_00019869 predicted 684
6 SASI_Hs02_00302066 predicted 594
7 SASI_Hs01_00019871 predicted 687
8 SASI_Hs02_00302067 predicted 883
9 SASI_Hs02_00302068 predicted 876
10 SASI_Hs02_00302069 predicted 1045
11 SASI_Hs01_00019862 predicted 644
12 SASI_Hs01_00019865 predicted 677
13 SASI_Hs01_00019866 predicted 496
14 SASI_Hs01_00019868 predicted 1260
15 SASI_Hs01_00019870 predicted 1155
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153193 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00078585 predicted 669
2 SASI_Mm01_00078586 predicted 404
3 SASI_Mm01_00078587 predicted 877
4 SASI_Mm01_00078589 predicted 1064
5 SASI_Mm01_00078590 predicted 1422
6 SASI_Mm01_00078591 predicted 678
7 SASI_Mm01_00078588 predicted 518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153193
HSD3B2 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000041668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-933s1c1
Sequence:CCGGTGGCCCTTAAACATAAGGGTACTCGAGTACCCTTATGTTTAAGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-713s1c1
Sequence:CCGGCCCAACTCTTACAAGGAGATTCTCGAGAATCTCCTTGTAAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-440s1c1
Sequence:CCGGAGACCAGAAACAAGGAAGGAACTCGAGTTCCTTCCTTGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-1189s1c1
Sequence:CCGGCCTACTGTACTGGCTTGCATTCTCGAGAATGCAAGCCAGTACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000041670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-989s1c1
Sequence:CCGGCCAGTATATGTGGGCAATGTACTCGAGTACATTGCCCACATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153193
HSD3B2 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000041668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-933s1c1
Sequence:CCGGTGGCCCTTAAACATAAGGGTACTCGAGTACCCTTATGTTTAAGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-713s1c1
Sequence:CCGGCCCAACTCTTACAAGGAGATTCTCGAGAATCTCCTTGTAAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-440s1c1
Sequence:CCGGAGACCAGAAACAAGGAAGGAACTCGAGTTCCTTCCTTGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-1189s1c1
Sequence:CCGGCCTACTGTACTGGCTTGCATTCTCGAGAATGCAAGCCAGTACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000041670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-989s1c1
Sequence:CCGGCCAGTATATGTGGGCAATGTACTCGAGTACATTGCCCACATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153193
HSD3B2 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000041668    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-933s1c1
Sequence:CCGGTGGCCCTTAAACATAAGGGTACTCGAGTACCCTTATGTTTAAGGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041669    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-713s1c1
Sequence:CCGGCCCAACTCTTACAAGGAGATTCTCGAGAATCTCCTTGTAAGAGTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041671    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-440s1c1
Sequence:CCGGAGACCAGAAACAAGGAAGGAACTCGAGTTCCTTCCTTGTTTCTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041672    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-1189s1c1
Sequence:CCGGCCTACTGTACTGGCTTGCATTCTCGAGAATGCAAGCCAGTACAGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000041670    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153193.2-989s1c1
Sequence:CCGGCCAGTATATGTGGGCAATGTACTCGAGTACATTGCCCACATATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000198
HSD3B2 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-390s1c1
Sequence:CCGGGCCTGTATCATTGATGTCTTTCTCGAGAAAGACATCAATGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-312s1c1
Sequence:CCGGACTGTACTTGAAGGAGACATTCTCGAGAATGTCTCCTTCAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-890s1c1
Sequence:CCGGCCGAGGTCAATTCTATTACATCTCGAGATGTAATAGAATTGACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-309s21c1
Sequence:CCGGCTGTACTTGAAGGAGACATTCCTCGAGGAATGTCTCCTTCAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000198.2-1294s21c1
Sequence:CCGGTGTTAGGAAATGTCATCAAACCTCGAGGTTTGATGACATTTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-1086s21c1
Sequence:CCGGACCGCCACACAGTCACATTATCTCGAGATAATGTGACTGTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-689s21c1
Sequence:CCGGGCGTTAAGACCCACATATATCCTCGAGGATATATGTGGGTCTTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-877s21c1
Sequence:CCGGCCCAAGTGTCCGAGGTCAATTCTCGAGAATTGACCTCGGACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000198
HSD3B2 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-390s1c1
Sequence:CCGGGCCTGTATCATTGATGTCTTTCTCGAGAAAGACATCAATGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-312s1c1
Sequence:CCGGACTGTACTTGAAGGAGACATTCTCGAGAATGTCTCCTTCAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-890s1c1
Sequence:CCGGCCGAGGTCAATTCTATTACATCTCGAGATGTAATAGAATTGACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-309s21c1
Sequence:CCGGCTGTACTTGAAGGAGACATTCCTCGAGGAATGTCTCCTTCAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000198.2-1294s21c1
Sequence:CCGGTGTTAGGAAATGTCATCAAACCTCGAGGTTTGATGACATTTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-1086s21c1
Sequence:CCGGACCGCCACACAGTCACATTATCTCGAGATAATGTGACTGTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-689s21c1
Sequence:CCGGGCGTTAAGACCCACATATATCCTCGAGGATATATGTGGGTCTTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-877s21c1
Sequence:CCGGCCCAAGTGTCCGAGGTCAATTCTCGAGAATTGACCTCGGACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000198
HSD3B2 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036723    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-390s1c1
Sequence:CCGGGCCTGTATCATTGATGTCTTTCTCGAGAAAGACATCAATGATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-312s1c1
Sequence:CCGGACTGTACTTGAAGGAGACATTCTCGAGAATGTCTCCTTCAAGTACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000198.1-890s1c1
Sequence:CCGGCCGAGGTCAATTCTATTACATCTCGAGATGTAATAGAATTGACCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-309s21c1
Sequence:CCGGCTGTACTTGAAGGAGACATTCCTCGAGGAATGTCTCCTTCAAGTACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234520    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000198.2-1294s21c1
Sequence:CCGGTGTTAGGAAATGTCATCAAACCTCGAGGTTTGATGACATTTCCTAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-1086s21c1
Sequence:CCGGACCGCCACACAGTCACATTATCTCGAGATAATGTGACTGTGTGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-689s21c1
Sequence:CCGGGCGTTAAGACCCACATATATCCTCGAGGATATATGTGGGTCTTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000198.2-877s21c1
Sequence:CCGGCCCAAGTGTCCGAGGTCAATTCTCGAGAATTGACCTCGGACACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks