EMAIL THIS PAGE TO A FRIEND

HSD3BP4

hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 4

Species: Human HSD3BP4(128102)
Gene ID:
12 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_371285 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_371285 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_371285 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_371285 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_371285 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00249009 predicted 657
2 SASI_Hs01_00249010 predicted 587
3 SASI_Hs01_00249011 predicted 586
4 SASI_Hs01_00249012 predicted 243
5 SASI_Hs01_00249013 predicted 749
6 SASI_Hs01_00249014 predicted 578
7 SASI_Hs01_00249015 predicted 550
8 SASI_Hs01_00249016 predicted 275
9 SASI_Hs01_00249017 predicted 623
10 SASI_Hs01_00249018 predicted 273
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_371285
HSD3BP4 MISSION shRNA Bacterial Glycerol Stock
hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 4
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000026571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1105s1c1
Sequence:CCGGCCGACTTTACATAACCAGGTACTCGAGTACCTGGTTATGTAAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-873s1c1
Sequence:CCGGCCAACTTCAGACTCTTGATATCTCGAGATATCAAGAGTCTGAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-611s1c1
Sequence:CCGGCCTATGCAACAACATCTTTATCTCGAGATAAAGATGTTGTTGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1449s1c1
Sequence:CCGGCCTGTCAAGTTTCAGCAAGTTCTCGAGAACTTGCTGAAACTTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000026567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1078s1c1
Sequence:CCGGGCAGGGTTTAAAGGAAGGTTTCTCGAGAAACCTTCCTTTAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_371285
HSD3BP4 MISSION shRNA shRNA Plasmid DNA
hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 4
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000026571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1105s1c1
Sequence:CCGGCCGACTTTACATAACCAGGTACTCGAGTACCTGGTTATGTAAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-873s1c1
Sequence:CCGGCCAACTTCAGACTCTTGATATCTCGAGATATCAAGAGTCTGAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-611s1c1
Sequence:CCGGCCTATGCAACAACATCTTTATCTCGAGATAAAGATGTTGTTGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1449s1c1
Sequence:CCGGCCTGTCAAGTTTCAGCAAGTTCTCGAGAACTTGCTGAAACTTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000026567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1078s1c1
Sequence:CCGGGCAGGGTTTAAAGGAAGGTTTCTCGAGAAACCTTCCTTTAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_371285
HSD3BP4 MISSION shRNA Lentiviral Transduction Particles
hydroxy-delta-5-steroid dehydrogenase, 3 beta, pseudogene 4
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000026571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1105s1c1
Sequence:CCGGCCGACTTTACATAACCAGGTACTCGAGTACCTGGTTATGTAAAGTCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026583    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-873s1c1
Sequence:CCGGCCAACTTCAGACTCTTGATATCTCGAGATATCAAGAGTCTGAAGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026509    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-611s1c1
Sequence:CCGGCCTATGCAACAACATCTTTATCTCGAGATAAAGATGTTGTTGCATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026508    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1449s1c1
Sequence:CCGGCCTGTCAAGTTTCAGCAAGTTCTCGAGAACTTGCTGAAACTTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000026567    
Product Details

Region:CDS
TRC Version: 1 Clone ID:XM_371285.1-1078s1c1
Sequence:CCGGGCAGGGTTTAAAGGAAGGTTTCTCGAGAAACCTTCCTTTAAACCCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks