EMAIL THIS PAGE TO A FRIEND

HSF1

heat shock transcription factor 1

Synonyms: HSTF1
UniProtKB ID: Q00613, A8K4L0, A8MW26, Q53XT4
Gene ID:
Human(3297) Summary: The product of this gene is a heat-shock transcription factor. Transcription of heat-shock genes is rapidly induced after temperature stress. Hsp90, by itself and/or associated with multichaperone complexes, is a major repressor of this gene. [provided by RefSeq, Jul 2008]
Mouse(15499) heat shock factor 1
Rat(79245) heat shock transcription factor 1
Zebrafish(58123) heat shock transcription factor 1
Thale Cress(827496) heat stress transcription factor A-1a
chicken(422169) heat shock transcription factor 1
dog(475124) heat shock transcription factor 1
domestic cat(101101364) heat shock transcription factor 1
cow(506235) heat shock transcription factor 1
sheep(101109368) heat shock transcription factor 1
Domestic Rabbit(100350887) heat shock transcription factor 1
domestic guinea pig(101787582) heat shock transcription factor 1
naked mole-rat(101724242) heat shock transcription factor 1
118 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
H4163 Anti-Heat Shock Factor 1 antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human, mouse, rat
microarray, western blot pricing
SAB4300509 Anti-HSF1 (Ab-303) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4300466 Anti-HSF1 (Ab-307) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
AV100769 Anti-HSF1 (AB1) antibody produced in rabbit affinity isolated antibody, lyophilized powder rat, pig, human, mouse, guinea pig, canine, bovine, rabbit
western blot pricing
AV36894 Anti-HSF1 (AB2) antibody produced in rabbit affinity isolated antibody mouse, rabbit, human, guinea pig, rat, bovine, horse
western blot pricing
SAB2107859 Anti-HSF1 antibody produced in rabbit affinity isolated antibody mouse, canine, pig, human, rabbit, rat, bovine, guinea pig
western blot pricing
HPA008888 Anti-HSF1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
AV36895 Anti-HSF1 antibody produced in rabbit IgG fraction of antiserum human, bovine, horse, mouse, guinea pig, rabbit, rat
western blot pricing
SAB4501448 Anti-HSF1 antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry, western blot pricing
SAB4501449 Anti-HSF1 antibody produced in rabbit affinity isolated antibody human, mouse
ELISA, western blot pricing
SAB4501450 Anti-HSF1 antibody produced in rabbit affinity isolated antibody mouse, human
ELISA, western blot pricing
SAB1306164 ANTI-HSF1 SUMOYLATION SITE antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunofluorescence, western blot pricing
SAB4504588 Anti-phospho-HSF1 (pSer121) antibody produced in rabbit affinity isolated antibody mouse, human, rat
ELISA, immunohistochemistry, western blot pricing
SAB4300208 Anti-phospho-HSF1 (pSer303) antibody produced in rabbit affinity isolated antibody human
immunohistochemistry, western blot pricing
SAB4504431 Anti-phospho-HSF1 (pSer303) antibody produced in rabbit affinity isolated antibody rat, mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB4300157 Anti-phospho-HSF1 (pSer307) antibody produced in rabbit affinity isolated antibody human
immunofluorescence, western blot pricing
SAB4504587 Anti-phospho-HSF1 (pThr142) antibody produced in rabbit affinity isolated antibody human, mouse, rat
ELISA, immunohistochemistry pricing
SAB4301278 Anti-phospho-HSF1 (pThr142) antibody produced in rabbit affinity isolated antibody human, mouse
immunohistochemistry pricing
SAB5201707 Monoclonal Anti-Hsf1 - Alkaline Phosphatase antibody produced in rat clone 10H4, purified immunoglobulin bovine, hamster, rabbit, rat, monkey, human, mouse, guinea pig
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201725 Monoclonal Anti-Hsf1 - Alkaline Phosphatase antibody produced in rat clone 4B4, purified immunoglobulin mouse, hamster, monkey, bovine, rabbit, human, rat, guinea pig
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201708 Monoclonal Anti-Hsf1 - Apc antibody produced in rat clone 10H4, purified immunoglobulin guinea pig, monkey, mouse, rat, rabbit, bovine, human, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201726 Monoclonal Anti-Hsf1 - Apc antibody produced in rat clone 4B4, purified immunoglobulin mouse, human, rat, rabbit, guinea pig, monkey, hamster, bovine
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201699 Monoclonal Anti-Hsf1 - Atto 390 antibody produced in rat clone 10H4, purified immunoglobulin rat, mouse, guinea pig, monkey, rabbit, bovine, human, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201717 Monoclonal Anti-Hsf1 - Atto 390 antibody produced in rat clone 4B4, purified immunoglobulin mouse, rabbit, bovine, guinea pig, monkey, human, rat, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201700 Monoclonal Anti-Hsf1 - Atto 488 antibody produced in rat clone 10H4, purified immunoglobulin human, rat, hamster, monkey, guinea pig, mouse, bovine, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201718 Monoclonal Anti-Hsf1 - Atto 488 antibody produced in rat clone 4B4, purified immunoglobulin rat, human, hamster, mouse, bovine, monkey, guinea pig, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201701 Monoclonal Anti-Hsf1 - Atto 565 antibody produced in rat clone 10H4, purified immunoglobulin rat, guinea pig, hamster, rabbit, human, mouse, bovine, monkey
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201719 Monoclonal Anti-Hsf1 - Atto 565 antibody produced in rat clone 4B4, purified immunoglobulin mouse, rabbit, bovine, rat, guinea pig, hamster, monkey, human
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201702 Monoclonal Anti-Hsf1 - Atto 594 antibody produced in rat clone 10H4, purified immunoglobulin rat, guinea pig, hamster, monkey, bovine, rabbit, mouse, human
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201720 Monoclonal Anti-Hsf1 - Atto 594 antibody produced in rat clone 4B4, purified immunoglobulin guinea pig, hamster, rabbit, rat, bovine, human, monkey, mouse
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201703 Monoclonal Anti-Hsf1 - Atto 633 antibody produced in rat clone 10H4, purified immunoglobulin bovine, guinea pig, hamster, rat, rabbit, human, monkey, mouse
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201721 Monoclonal Anti-Hsf1 - Atto 633 antibody produced in rat clone 4B4, purified immunoglobulin mouse, human, rat, bovine, hamster, guinea pig, monkey, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201704 Monoclonal Anti-Hsf1 - Atto 655 antibody produced in rat clone 10H4, purified immunoglobulin human, guinea pig, mouse, bovine, rabbit, rat, hamster, monkey
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201722 Monoclonal Anti-Hsf1 - Atto 655 antibody produced in rat clone 4B4, purified immunoglobulin mouse, bovine, rabbit, rat, hamster, guinea pig, monkey, human
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201705 Monoclonal Anti-Hsf1 - Atto 680 antibody produced in rat clone 10H4, purified immunoglobulin mouse, bovine, rabbit, human, rat, monkey, guinea pig, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201723 Monoclonal Anti-Hsf1 - Atto 680 antibody produced in rat clone 4B4, purified immunoglobulin human, mouse, rat, hamster, rabbit, guinea pig, monkey, bovine
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201706 Monoclonal Anti-Hsf1 - Atto 700 antibody produced in rat clone 10H4, purified immunoglobulin hamster, mouse, guinea pig, bovine, rabbit, human, rat, monkey
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201724 Monoclonal Anti-Hsf1 - Atto 700 antibody produced in rat clone 4B4, purified immunoglobulin bovine, monkey, human, rabbit, hamster, mouse, rat, guinea pig
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201709 Monoclonal Anti-Hsf1 - Biotin antibody produced in rat clone 10H4, purified immunoglobulin hamster, mouse, bovine, human, rat, guinea pig, monkey, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201727 Monoclonal Anti-Hsf1 - Biotin antibody produced in rat clone 4B4, purified immunoglobulin rat, bovine, monkey, rabbit, hamster, human, mouse, guinea pig
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201710 Monoclonal Anti-Hsf1 - Fitc antibody produced in rat clone 10H4, purified immunoglobulin bovine, guinea pig, rat, human, monkey, mouse, hamster, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201728 Monoclonal Anti-Hsf1 - Fitc antibody produced in rat clone 4B4, purified immunoglobulin guinea pig, mouse, human, rat, bovine, hamster, monkey, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201711 Monoclonal Anti-Hsf1 - Hrp antibody produced in rat clone 10H4, purified immunoglobulin human, rat, monkey, mouse, bovine, guinea pig, hamster, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201729 Monoclonal Anti-Hsf1 - Hrp antibody produced in rat clone 4B4, purified immunoglobulin human, bovine, rat, hamster, monkey, rabbit, guinea pig, mouse
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201712 Monoclonal Anti-Hsf1 - Pe/Atto 594 antibody produced in rat clone 10H4, purified immunoglobulin human, guinea pig, monkey, mouse, bovine, rabbit, rat, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201730 Monoclonal Anti-Hsf1 - Pe/Atto 594 antibody produced in rat clone 4B4, purified immunoglobulin hamster, rabbit, rat, human, bovine, monkey, mouse, guinea pig
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201713 Monoclonal Anti-Hsf1 - Percp antibody produced in rat clone 10H4, purified immunoglobulin rat, mouse, human, bovine, hamster, guinea pig, monkey, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201731 Monoclonal Anti-Hsf1 - Percp antibody produced in rat clone 4B4, purified immunoglobulin bovine, hamster, monkey, mouse, guinea pig, human, rat, rabbit
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201714 Monoclonal Anti-Hsf1 - Rpe antibody produced in rat clone 10H4, purified immunoglobulin mouse, bovine, monkey, rabbit, guinea pig, human, rat, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201732 Monoclonal Anti-Hsf1 - Rpe antibody produced in rat clone 4B4, purified immunoglobulin mouse, monkey, rabbit, human, bovine, guinea pig, rat, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201715 Monoclonal Anti-Hsf1 - Streptavidin antibody produced in rat clone 10H4, purified immunoglobulin guinea pig, monkey, rabbit, rat, mouse, bovine, human, hamster
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201733 Monoclonal Anti-Hsf1 - Streptavidin antibody produced in rat clone 4B4, purified immunoglobulin human, mouse, rat, monkey, rabbit, hamster, bovine, guinea pig
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB1402812 Monoclonal Anti-HSF1 antibody produced in mouse clone 1A11, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB5201698 Monoclonal Anti-Hsf1 antibody produced in rat clone 10H4, purified immunoglobulin guinea pig, rabbit, human, mouse, bovine, hamster, rat, monkey
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing
SAB5201716 Monoclonal Anti-Hsf1 antibody produced in rat clone 4B4, purified immunoglobulin bovine, human, guinea pig, rabbit, mouse, rat, hamster, monkey
ELISA, immunocytochemistry, immunoprecipitation, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_008296 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008296 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008296 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005526 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005526 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005526 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005526 Rosetta Predictions human pricing
XM_001061027 Rosetta Predictions rat pricing
XM_001075095 Rosetta Predictions rat pricing
NM_008296 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005526 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339745 predicted 824
2 SASI_Hs01_00067735 predicted 1435
3 SASI_Hs01_00067737 predicted 1315
4 SASI_Hs01_00067738 predicted 521
5 SASI_Hs02_00339746 predicted 807
6 SASI_Hs01_00067739 predicted 1524
7 SASI_Hs01_00067740 predicted 441
8 SASI_Hs01_00067741 predicted 828
9 SASI_Hs01_00067742 predicted 1166
10 SASI_Hs02_00339747 predicted 1616
11 SASI_Hs01_00067734 predicted 820
12 SASI_Hs01_00067736 predicted 798
13 SASI_Hs01_00067743 predicted 489
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001061027 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00298528 predicted 860
2 SASI_Rn02_00298529 predicted 1569
3 SASI_Rn02_00298530 predicted 1338
4 SASI_Rn02_00298531 predicted 946
5 SASI_Rn02_00298532 predicted 1528
6 SASI_Rn02_00298533 predicted 1543
7 SASI_Rn02_00298534 predicted 1383
8 SASI_Rn02_00298535 predicted 810
9 SASI_Rn02_00298536 predicted 986
10 SASI_Rn02_00298537 predicted 620
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001075095 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00348444 predicted 1660
2 SASI_Rn02_00348445 predicted 851
3 SASI_Rn02_00348446 predicted 1557
4 SASI_Rn02_00348447 predicted 1319
5 SASI_Rn02_00348448 predicted 931
6 SASI_Rn02_00348449 predicted 1518
7 SASI_Rn02_00348450 predicted 1531
8 SASI_Rn02_00348451 predicted 1377
9 SASI_Rn02_00348452 predicted 799
10 SASI_Rn02_00348453 predicted 968
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008296 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023055 predicted 816
2 SASI_Mm01_00023056 predicted 1425
3 SASI_Mm01_00023057 predicted 1459
4 SASI_Mm01_00023058 predicted 902
5 SASI_Mm01_00023059 predicted 720
6 SASI_Mm01_00023060 predicted 1346
7 SASI_Mm01_00023061 predicted 767
8 SASI_Mm02_00313575 predicted 324
9 SASI_Mm01_00023063 predicted 520
10 SASI_Mm01_00023064 predicted 1707
11 SASI_Mm01_00023062 predicted 946
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008296
VALIDATED
HSF1 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-1856s1c1
Sequence:CCGGGCTGCATACCTGCTGCCTTTACTCGAGTAAAGGCAGCAGGTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-527s1c1
Sequence:CCGGCCCTGAAGAGTGAGGACATAACTCGAGTTATGTCCTCACTCTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-369s1c1
Sequence:CCGGGCAGCTCAACATGTATGGCTTCTCGAGAAGCCATACATGTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-938s1c1
Sequence:CCGGCTGGACCCATAATCTCCGATACTCGAGTATCGGAGATTATGGGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-527s21c1
Sequence:CCGGCCCTGAAGAGTGAGGACATAACTCGAGTTATGTCCTCACTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008296.2-278s21c1
Sequence:CCGGGGAACAGCTTCCACGTGTTTGCTCGAGCAAACACGTGGAAGCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-938s21c1
Sequence:CCGGCTGGACCCATAATCTCCGATACTCGAGTATCGGAGATTATGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-1277s21c1
Sequence:CCGGGCCTAGACAAGAACGAGCTAACTCGAGTTAGCTCGTTCTTGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008296.2-1856s21c1
Sequence:CCGGGCTGCATACCTGCTGCCTTTACTCGAGTAAAGGCAGCAGGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008296
VALIDATED
HSF1 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-1856s1c1
Sequence:CCGGGCTGCATACCTGCTGCCTTTACTCGAGTAAAGGCAGCAGGTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-527s1c1
Sequence:CCGGCCCTGAAGAGTGAGGACATAACTCGAGTTATGTCCTCACTCTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-369s1c1
Sequence:CCGGGCAGCTCAACATGTATGGCTTCTCGAGAAGCCATACATGTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-938s1c1
Sequence:CCGGCTGGACCCATAATCTCCGATACTCGAGTATCGGAGATTATGGGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-527s21c1
Sequence:CCGGCCCTGAAGAGTGAGGACATAACTCGAGTTATGTCCTCACTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008296.2-278s21c1
Sequence:CCGGGGAACAGCTTCCACGTGTTTGCTCGAGCAAACACGTGGAAGCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-938s21c1
Sequence:CCGGCTGGACCCATAATCTCCGATACTCGAGTATCGGAGATTATGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-1277s21c1
Sequence:CCGGGCCTAGACAAGAACGAGCTAACTCGAGTTAGCTCGTTCTTGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008296.2-1856s21c1
Sequence:CCGGGCTGCATACCTGCTGCCTTTACTCGAGTAAAGGCAGCAGGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008296
VALIDATED
HSF1 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008502    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-1856s1c1
Sequence:CCGGGCTGCATACCTGCTGCCTTTACTCGAGTAAAGGCAGCAGGTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008503    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-527s1c1
Sequence:CCGGCCCTGAAGAGTGAGGACATAACTCGAGTTATGTCCTCACTCTTCAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008505    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-369s1c1
Sequence:CCGGGCAGCTCAACATGTATGGCTTCTCGAGAAGCCATACATGTTGAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008504    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008296.1-938s1c1
Sequence:CCGGCTGGACCCATAATCTCCGATACTCGAGTATCGGAGATTATGGGTCCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-527s21c1
Sequence:CCGGCCCTGAAGAGTGAGGACATAACTCGAGTTATGTCCTCACTCTTCAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008296.2-278s21c1
Sequence:CCGGGGAACAGCTTCCACGTGTTTGCTCGAGCAAACACGTGGAAGCTGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280459    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-938s21c1
Sequence:CCGGCTGGACCCATAATCTCCGATACTCGAGTATCGGAGATTATGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280519    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008296.2-1277s21c1
Sequence:CCGGGCCTAGACAAGAACGAGCTAACTCGAGTTAGCTCGTTCTTGTCTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280517    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_008296.2-1856s21c1
Sequence:CCGGGCTGCATACCTGCTGCCTTTACTCGAGTAAAGGCAGCAGGTATGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005526
VALIDATED
HSF1 MISSION shRNA Bacterial Glycerol Stock
heat shock transcription factor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005526.1-815s1c1
Sequence:CCGGGCACATTCCATGCCCAAGTATCTCGAGATACTTGGGCATGGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-1999s1c1
Sequence:CCGGGCAGGTTGTTCATAGTCAGAACTCGAGTTCTGACTATGAACAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005526.1-1312s1c1
Sequence:CCGGCAGTGACCACTTGGATGCTATCTCGAGATAGCATCCAAGTGGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-700s1c1
Sequence:CCGGCCAGCAACAGAAAGTCGTCAACTCGAGTTGACGACTTTCTGTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-331s1c1
Sequence:CCGGGCCCAAGTACTTCAAGCACAACTCGAGTTGTGCTTGAAGTACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-1322s21c1
Sequence:CCGGCAGTGACCACTTGGATGCTATCTCGAGATAGCATCCAAGTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005526.2-2009s21c1
Sequence:CCGGGCAGGTTGTTCATAGTCAGAACTCGAGTTCTGACTATGAACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-825s21c1
Sequence:CCGGGCACATTCCATGCCCAAGTATCTCGAGATACTTGGGCATGGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000318651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-710s21c1
Sequence:CCGGCCAGCAACAGAAAGTCGTCAACTCGAGTTGACGACTTTCTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005526
VALIDATED
HSF1 MISSION shRNA shRNA Plasmid DNA
heat shock transcription factor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005526.1-815s1c1
Sequence:CCGGGCACATTCCATGCCCAAGTATCTCGAGATACTTGGGCATGGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-1999s1c1
Sequence:CCGGGCAGGTTGTTCATAGTCAGAACTCGAGTTCTGACTATGAACAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005526.1-1312s1c1
Sequence:CCGGCAGTGACCACTTGGATGCTATCTCGAGATAGCATCCAAGTGGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-700s1c1
Sequence:CCGGCCAGCAACAGAAAGTCGTCAACTCGAGTTGACGACTTTCTGTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-331s1c1
Sequence:CCGGGCCCAAGTACTTCAAGCACAACTCGAGTTGTGCTTGAAGTACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-1322s21c1
Sequence:CCGGCAGTGACCACTTGGATGCTATCTCGAGATAGCATCCAAGTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005526.2-2009s21c1
Sequence:CCGGGCAGGTTGTTCATAGTCAGAACTCGAGTTCTGACTATGAACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-825s21c1
Sequence:CCGGGCACATTCCATGCCCAAGTATCTCGAGATACTTGGGCATGGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000318651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-710s21c1
Sequence:CCGGCCAGCAACAGAAAGTCGTCAACTCGAGTTGACGACTTTCTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005526
VALIDATED
HSF1 MISSION shRNA Lentiviral Transduction Particles
heat shock transcription factor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007481    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005526.1-815s1c1
Sequence:CCGGGCACATTCCATGCCCAAGTATCTCGAGATACTTGGGCATGGAATGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007480    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-1999s1c1
Sequence:CCGGGCAGGTTGTTCATAGTCAGAACTCGAGTTCTGACTATGAACAACCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007484    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005526.1-1312s1c1
Sequence:CCGGCAGTGACCACTTGGATGCTATCTCGAGATAGCATCCAAGTGGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007482    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-700s1c1
Sequence:CCGGCCAGCAACAGAAAGTCGTCAACTCGAGTTGACGACTTTCTGTTGCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005526.1-331s1c1
Sequence:CCGGGCCCAAGTACTTCAAGCACAACTCGAGTTGTGCTTGAAGTACTTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318711    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-1322s21c1
Sequence:CCGGCAGTGACCACTTGGATGCTATCTCGAGATAGCATCCAAGTGGTCACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318712    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005526.2-2009s21c1
Sequence:CCGGGCAGGTTGTTCATAGTCAGAACTCGAGTTCTGACTATGAACAACCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318652    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-825s21c1
Sequence:CCGGGCACATTCCATGCCCAAGTATCTCGAGATACTTGGGCATGGAATGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000318651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005526.2-710s21c1
Sequence:CCGGCCAGCAACAGAAAGTCGTCAACTCGAGTTGACGACTTTCTGTTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks