EMAIL THIS PAGE TO A FRIEND

HSPA14

heat shock 70kDa protein 14

Synonyms: HSP70-4 HSP70L1
UniProtKB ID: Q0VDF9, A8K8F8, B0YIY9, Q9P0X2, Q9UI07
Gene ID:
Mouse(50497) heat shock protein 14
Rat(307133) heat shock protein 14
Zebrafish(565232) heat shock protein 14
chicken(418802) heat shock 70kDa protein 14
cow(534751) heat shock 70kDa protein 14
Horse(100056381) heat shock 70kDa protein 14
domestic cat(101088761) heat shock 70kDa protein 14
dog(477996) heat shock 70kDa protein 14
domestic guinea pig(100716355) heat shock 70kDa protein 14
naked mole-rat(101702271) heat shock 70kDa protein 14
sheep(101108674) heat shock 70kDa protein 14
Domestic Rabbit(100355961) heat shock 70kDa protein 14
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016299 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016299 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016299 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015765 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015765 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015765 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001037538 Rosetta Predictions human pricing
NM_016299 Rosetta Predictions human pricing
NM_001004257 Rosetta Predictions rat pricing
NM_015765 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037538 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172726 predicted 252
2 SASI_Hs01_00172727 predicted 829
3 SASI_Hs01_00172728 predicted 567
4 SASI_Hs01_00172729 predicted 737
5 SASI_Hs01_00172730 predicted 691
6 SASI_Hs01_00172731 predicted 689
7 SASI_Hs01_00172732 predicted 421
8 SASI_Hs01_00172733 predicted 720
9 SASI_Hs01_00172734 predicted 868
10 SASI_Hs01_00172735 predicted 613
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016299 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00169384 predicted 729
2 SASI_Hs01_00169385 predicted 1026
3 SASI_Hs02_00349222 predicted 763
4 SASI_Hs01_00169386 predicted 538
5 SASI_Hs01_00169387 predicted 771
6 SASI_Hs01_00169388 predicted 475
7 SASI_Hs01_00169389 predicted 1137
8 SASI_Hs01_00169390 predicted 759
9 SASI_Hs01_00169392 predicted 743
10 SASI_Hs02_00349223 predicted 1451
11 SASI_Hs01_00169383 predicted 536
12 SASI_Hs01_00169391 predicted 833
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001004257 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074586 predicted 303
2 SASI_Rn01_00074589 predicted 493
3 SASI_Rn01_00074590 predicted 749
4 SASI_Rn01_00074591 predicted 432
5 SASI_Rn02_00198275 predicted 1391
6 SASI_Rn01_00074592 predicted 955
7 SASI_Rn01_00074593 predicted 1402
8 SASI_Rn01_00074594 predicted 547
9 SASI_Rn01_00074595 predicted 476
10 SASI_Rn02_00198276 predicted 1042
11 SASI_Rn01_00074587 predicted 368
12 SASI_Rn01_00074588 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015765 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00323098 predicted 1097
2 SASI_Mm01_00077815 predicted 420
3 SASI_Mm01_00077816 predicted 608
4 SASI_Mm01_00077817 predicted 1342
5 SASI_Mm01_00077818 predicted 461
6 SASI_Mm01_00077820 predicted 1296
7 SASI_Mm01_00077821 predicted 1482
8 SASI_Mm01_00077822 predicted 1272
9 SASI_Mm01_00077823 predicted 377
10 SASI_Mm01_00077824 predicted 721
11 SASI_Mm01_00077819 predicted 963
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016299
VALIDATED
HSPA14 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 14
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000280322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016299.2-490s21c1
Sequence:CCGGGCCAGACTGATATTTAGTAAACTCGAGTTTACTAAATATCAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016299.2-904s21c1
Sequence:CCGGGCGCGAGCCATGATGAAATTACTCGAGTAATTTCATCATGGCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016299.2-1495s21c1
Sequence:CCGGGCCAAAGAGGAAACCAAGTTTCTCGAGAAACTTGGTTTCCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016299.2-1252s21c1
Sequence:CCGGGCAGCTATAGAAGCAGGAATTCTCGAGAATTCCTGCTTCTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-411s1c1
Sequence:CCGGGCCAGACTGATATTTAGTAAACTCGAGTTTACTAAATATCAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-1416s1c1
Sequence:CCGGGCCAAAGAGGAAACCAAGTTTCTCGAGAAACTTGGTTTCCTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-300s1c1
Sequence:CCGGGCTCAGAAATACATCGCGGAACTCGAGTTCCGCGATGTATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-1173s1c1
Sequence:CCGGGCAGCTATAGAAGCAGGAATTCTCGAGAATTCCTGCTTCTATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016299.1-825s1c1
Sequence:CCGGGCGCGAGCCATGATGAAATTACTCGAGTAATTTCATCATGGCTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016299
VALIDATED
HSPA14 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 14
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000280322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016299.2-490s21c1
Sequence:CCGGGCCAGACTGATATTTAGTAAACTCGAGTTTACTAAATATCAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016299.2-904s21c1
Sequence:CCGGGCGCGAGCCATGATGAAATTACTCGAGTAATTTCATCATGGCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016299.2-1495s21c1
Sequence:CCGGGCCAAAGAGGAAACCAAGTTTCTCGAGAAACTTGGTTTCCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016299.2-1252s21c1
Sequence:CCGGGCAGCTATAGAAGCAGGAATTCTCGAGAATTCCTGCTTCTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-411s1c1
Sequence:CCGGGCCAGACTGATATTTAGTAAACTCGAGTTTACTAAATATCAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-1416s1c1
Sequence:CCGGGCCAAAGAGGAAACCAAGTTTCTCGAGAAACTTGGTTTCCTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-300s1c1
Sequence:CCGGGCTCAGAAATACATCGCGGAACTCGAGTTCCGCGATGTATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-1173s1c1
Sequence:CCGGGCAGCTATAGAAGCAGGAATTCTCGAGAATTCCTGCTTCTATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016299.1-825s1c1
Sequence:CCGGGCGCGAGCCATGATGAAATTACTCGAGTAATTTCATCATGGCTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016299
VALIDATED
HSPA14 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 14
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000280322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016299.2-490s21c1
Sequence:CCGGGCCAGACTGATATTTAGTAAACTCGAGTTTACTAAATATCAGTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280265    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016299.2-904s21c1
Sequence:CCGGGCGCGAGCCATGATGAAATTACTCGAGTAATTTCATCATGGCTCGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280323    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016299.2-1495s21c1
Sequence:CCGGGCCAAAGAGGAAACCAAGTTTCTCGAGAAACTTGGTTTCCTCTTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_016299.2-1252s21c1
Sequence:CCGGGCAGCTATAGAAGCAGGAATTCTCGAGAATTCCTGCTTCTATAGCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008764    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-411s1c1
Sequence:CCGGGCCAGACTGATATTTAGTAAACTCGAGTTTACTAAATATCAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008765    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-1416s1c1
Sequence:CCGGGCCAAAGAGGAAACCAAGTTTCTCGAGAAACTTGGTTTCCTCTTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-300s1c1
Sequence:CCGGGCTCAGAAATACATCGCGGAACTCGAGTTCCGCGATGTATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_016299.1-1173s1c1
Sequence:CCGGGCAGCTATAGAAGCAGGAATTCTCGAGAATTCCTGCTTCTATAGCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016299.1-825s1c1
Sequence:CCGGGCGCGAGCCATGATGAAATTACTCGAGTAATTTCATCATGGCTCGCGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015765
VALIDATED
HSPA14 MISSION shRNA Bacterial Glycerol Stock
heat shock 70kDa protein 14
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000008519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-322s1c1
Sequence:CCGGGCTCAGAAATACATCTCAGAACTCGAGTTCTGAGATGTATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015765.1-1595s1c1
Sequence:CCGGCCATTACTGTTGAGGTTGCATCTCGAGATGCAACCTCAACAGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-1456s1c1
Sequence:CCGGGCCAAGTTTGCACAGGTTGTACTCGAGTACAACCTGTGCAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015765.1-1510s1c1
Sequence:CCGGCGTGATATATTAGCTGTTCTTCTCGAGAAGAACAGCTAATATATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000008517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-433s1c1
Sequence:CCGGGCCAGACTGATATTCAGTAAACTCGAGTTTACTGAATATCAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015765
VALIDATED
HSPA14 MISSION shRNA shRNA Plasmid DNA
heat shock 70kDa protein 14
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000008519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-322s1c1
Sequence:CCGGGCTCAGAAATACATCTCAGAACTCGAGTTCTGAGATGTATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015765.1-1595s1c1
Sequence:CCGGCCATTACTGTTGAGGTTGCATCTCGAGATGCAACCTCAACAGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-1456s1c1
Sequence:CCGGGCCAAGTTTGCACAGGTTGTACTCGAGTACAACCTGTGCAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015765.1-1510s1c1
Sequence:CCGGCGTGATATATTAGCTGTTCTTCTCGAGAAGAACAGCTAATATATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000008517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-433s1c1
Sequence:CCGGGCCAGACTGATATTCAGTAAACTCGAGTTTACTGAATATCAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015765
VALIDATED
HSPA14 MISSION shRNA Lentiviral Transduction Particles
heat shock 70kDa protein 14
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000008519    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-322s1c1
Sequence:CCGGGCTCAGAAATACATCTCAGAACTCGAGTTCTGAGATGTATTTCTGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008521    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015765.1-1595s1c1
Sequence:CCGGCCATTACTGTTGAGGTTGCATCTCGAGATGCAACCTCAACAGTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008520    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-1456s1c1
Sequence:CCGGGCCAAGTTTGCACAGGTTGTACTCGAGTACAACCTGTGCAAACTTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008518    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015765.1-1510s1c1
Sequence:CCGGCGTGATATATTAGCTGTTCTTCTCGAGAAGAACAGCTAATATATCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000008517    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_015765.1-433s1c1
Sequence:CCGGGCCAGACTGATATTCAGTAAACTCGAGTTTACTGAATATCAGTCTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks