EMAIL THIS PAGE TO A FRIEND

HSPB7

heat shock 27kDa protein family, member 7 (cardiovascular)

Synonyms: cvHSP
UniProtKB ID: Q9UBY9, B3KQ37, C9K0Y0, Q9NU17
Gene ID:
Mouse(29818) heat shock protein family, member 7 (cardiovascular)
Rat(50565) heat shock protein family, member 7 (cardiovascular)
Zebrafish(450019) heat shock protein family, alpha-crystallin-related, b7
cow(512251) heat shock 27kDa protein family, member 7 (cardiovascular)
domestic cat(101083188) heat shock 27kDa protein family, member 7 (cardiovascular)
dog(487423) heat shock 27kDa protein family, member 7 (cardiovascular)
chicken(430280) heat shock 27kDa protein family, member 7 (cardiovascular)
domestic guinea pig(100731021) heat shock 27kDa protein family, member 7 (cardiovascular)
naked mole-rat(101713235) heat shock 27kDa protein family, member 7 (cardiovascular)
sheep(101110827) heat shock 27kDa protein family, member 7 (cardiovascular)
48 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014424 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014424 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014424 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_013868 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013868 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013868 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU051221 MISSION® esiRNA esiRNA human HSPB7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014424 Rosetta Predictions human pricing
NM_031607 Rosetta Predictions rat pricing
NM_013868 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014424 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00130111 predicted 1684
2 SASI_Hs02_00345622 predicted 1682
3 SASI_Hs01_00130113 predicted 1786
4 SASI_Hs01_00130112 predicted 1680
5 SASI_Hs01_00130114 predicted 1835
6 SASI_Hs02_00345623 predicted 1785
7 SASI_Hs02_00345624 predicted 1839
8 SASI_Hs01_00130117 predicted 1306
9 SASI_Hs01_00130118 predicted 1471
10 SASI_Hs02_00345625 predicted 1675
11 SASI_Hs01_00130115 predicted 1363
12 SASI_Hs01_00130116 predicted 1446
13 SASI_Hs01_00130119 predicted 1197
14 SASI_Hs01_00130120 predicted 1222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031607 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00264888 predicted 398
2 SASI_Rn02_00264889 predicted 971
3 SASI_Rn02_00264890 predicted 1050
4 SASI_Rn02_00264891 predicted 401
5 SASI_Rn02_00264892 predicted 982
6 SASI_Rn02_00264893 predicted 967
7 SASI_Rn02_00264894 predicted 1045
8 SASI_Rn02_00264895 predicted 983
9 SASI_Rn02_00264896 predicted 541
10 SASI_Rn02_00264897 predicted 687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013868 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00161042 predicted 1478
2 SASI_Mm01_00161043 predicted 1918
3 SASI_Mm01_00161044 predicted 1920
4 SASI_Mm01_00161045 predicted 1488
5 SASI_Mm01_00161046 predicted 1763
6 SASI_Mm01_00161047 predicted 1722
7 SASI_Mm01_00161048 predicted 1335
8 SASI_Mm01_00161049 predicted 1663
9 SASI_Mm01_00161050 predicted 1728
10 SASI_Mm01_00161051 predicted 1735
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014424
HSPB7 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein family, member 7 (cardiovascular)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014424.3-1461s1c1
Sequence:CCGGCCTATCTAAGTGGAACTAATTCTCGAGAATTAGTTCCACTTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-847s1c1
Sequence:CCGGCATGAACACCTTCGCTCACAACTCGAGTTGTGAGCGAAGGTGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-522s1c1
Sequence:CCGGGAGCGGAGAGAAGTTTCCATTCTCGAGAATGGAAACTTCTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-755s1c1
Sequence:CCGGGTGAGAGACTTCTCACCTGAACTCGAGTTCAGGTGAGAAGTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-707s1c1
Sequence:CCGGGCAGGCAACATCAAGACCCTACTCGAGTAGGGTCTTGATGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014424.4-1554s21c1
Sequence:CCGGGATTTGGCCTCCGTCACTTAACTCGAGTTAAGTGACGGAGGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014424.4-975s21c1
Sequence:CCGGGATGACTTTGGCAGCTTCATGCTCGAGCATGAAGCTGCCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014424.4-1314s21c1
Sequence:CCGGACCTTCCGGACGGAGATCAAACTCGAGTTTGATCTCCGTCCGGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014424
HSPB7 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein family, member 7 (cardiovascular)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014424.3-1461s1c1
Sequence:CCGGCCTATCTAAGTGGAACTAATTCTCGAGAATTAGTTCCACTTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-847s1c1
Sequence:CCGGCATGAACACCTTCGCTCACAACTCGAGTTGTGAGCGAAGGTGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-522s1c1
Sequence:CCGGGAGCGGAGAGAAGTTTCCATTCTCGAGAATGGAAACTTCTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-755s1c1
Sequence:CCGGGTGAGAGACTTCTCACCTGAACTCGAGTTCAGGTGAGAAGTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-707s1c1
Sequence:CCGGGCAGGCAACATCAAGACCCTACTCGAGTAGGGTCTTGATGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014424.4-1554s21c1
Sequence:CCGGGATTTGGCCTCCGTCACTTAACTCGAGTTAAGTGACGGAGGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014424.4-975s21c1
Sequence:CCGGGATGACTTTGGCAGCTTCATGCTCGAGCATGAAGCTGCCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014424.4-1314s21c1
Sequence:CCGGACCTTCCGGACGGAGATCAAACTCGAGTTTGATCTCCGTCCGGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014424
HSPB7 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein family, member 7 (cardiovascular)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118347    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014424.3-1461s1c1
Sequence:CCGGCCTATCTAAGTGGAACTAATTCTCGAGAATTAGTTCCACTTAGATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-847s1c1
Sequence:CCGGCATGAACACCTTCGCTCACAACTCGAGTTGTGAGCGAAGGTGTTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-522s1c1
Sequence:CCGGGAGCGGAGAGAAGTTTCCATTCTCGAGAATGGAAACTTCTCTCCGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-755s1c1
Sequence:CCGGGTGAGAGACTTCTCACCTGAACTCGAGTTCAGGTGAGAAGTCTCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014424.3-707s1c1
Sequence:CCGGGCAGGCAACATCAAGACCCTACTCGAGTAGGGTCTTGATGTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432862    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014424.4-1554s21c1
Sequence:CCGGGATTTGGCCTCCGTCACTTAACTCGAGTTAAGTGACGGAGGCCAAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422861    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014424.4-975s21c1
Sequence:CCGGGATGACTTTGGCAGCTTCATGCTCGAGCATGAAGCTGCCAAAGTCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415978    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014424.4-1314s21c1
Sequence:CCGGACCTTCCGGACGGAGATCAAACTCGAGTTTGATCTCCGTCCGGAAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013868
HSPB7 MISSION shRNA Bacterial Glycerol Stock
heat shock 27kDa protein family, member 7 (cardiovascular)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000092608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013868.2-2305s1c1
Sequence:CCGGGCCCAATTCAAAGCATTCTAACTCGAGTTAGAATGCTTTGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1217s1c1
Sequence:CCGGCCAAGGAAACATCAAGACCCTCTCGAGAGGGTCTTGATGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1292s1c1
Sequence:CCGGCATTGTCACCACCTTCAACAACTCGAGTTGTTGAAGGTGGTGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1360s1c1
Sequence:CCGGTGAACACCTTTGCTCACAAGTCTCGAGACTTGTGAGCAAAGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000092612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1249s1c1
Sequence:CCGGACGAGTTTACAGTGGACATGACTCGAGTCATGTCCACTGTAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013868
HSPB7 MISSION shRNA shRNA Plasmid DNA
heat shock 27kDa protein family, member 7 (cardiovascular)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000092608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013868.2-2305s1c1
Sequence:CCGGGCCCAATTCAAAGCATTCTAACTCGAGTTAGAATGCTTTGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1217s1c1
Sequence:CCGGCCAAGGAAACATCAAGACCCTCTCGAGAGGGTCTTGATGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1292s1c1
Sequence:CCGGCATTGTCACCACCTTCAACAACTCGAGTTGTTGAAGGTGGTGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1360s1c1
Sequence:CCGGTGAACACCTTTGCTCACAAGTCTCGAGACTTGTGAGCAAAGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000092612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1249s1c1
Sequence:CCGGACGAGTTTACAGTGGACATGACTCGAGTCATGTCCACTGTAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013868
HSPB7 MISSION shRNA Lentiviral Transduction Particles
heat shock 27kDa protein family, member 7 (cardiovascular)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000092608    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013868.2-2305s1c1
Sequence:CCGGGCCCAATTCAAAGCATTCTAACTCGAGTTAGAATGCTTTGAATTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1217s1c1
Sequence:CCGGCCAAGGAAACATCAAGACCCTCTCGAGAGGGTCTTGATGTTTCCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092610    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1292s1c1
Sequence:CCGGCATTGTCACCACCTTCAACAACTCGAGTTGTTGAAGGTGGTGACAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1360s1c1
Sequence:CCGGTGAACACCTTTGCTCACAAGTCTCGAGACTTGTGAGCAAAGGTGTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000092612    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013868.2-1249s1c1
Sequence:CCGGACGAGTTTACAGTGGACATGACTCGAGTCATGTCCACTGTAAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks