EMAIL THIS PAGE TO A FRIEND

HSPBP1

HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1

Synonyms: FES1
UniProtKB ID: Q9NZL4, B3KQP0, O95351, Q6ZNU5
Gene ID:
Mouse(66245) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Rat(246146) HSPA binding protein, cytoplasmic cochaperone 1
Zebrafish(338155) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
cow(512757) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
dog(476381) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
domestic cat(101085335) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
domestic guinea pig(100713903) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
naked mole-rat(101708996) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
sheep(101121446) HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012267 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012267 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012267 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_024172 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_024172 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_024172 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU021791 MISSION® esiRNA esiRNA human AC116342.2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012267 Rosetta Predictions human pricing
NM_139261 Rosetta Predictions rat pricing
NM_024172 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012267 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00193075 predicted 662
2 SASI_Hs01_00193077 predicted 1057
3 SASI_Hs02_00343986 predicted 281
4 SASI_Hs01_00193078 predicted 678
5 SASI_Hs01_00193079 predicted 576
6 SASI_Hs01_00193080 predicted 1235
7 SASI_Hs01_00193081 predicted 790
8 SASI_Hs01_00193082 predicted 1188
9 SASI_Hs02_00343987 predicted 314
10 SASI_Hs01_00193083 predicted 1085
11 SASI_Hs01_00193076 predicted 1045
12 SASI_Hs01_00193084 predicted 1465
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_139261 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00067601 predicted 742
2 SASI_Rn01_00067602 predicted 963
3 SASI_Rn01_00067603 predicted 1011
4 SASI_Rn01_00067604 predicted 528
5 SASI_Rn01_00067605 predicted 613
6 SASI_Rn01_00067606 predicted 475
7 SASI_Rn01_00067608 predicted 826
8 SASI_Rn02_00268553 predicted 353
9 SASI_Rn01_00067609 predicted 510
10 SASI_Rn02_00268554 predicted 265
11 SASI_Rn01_00067607 predicted 302
12 SASI_Rn01_00067610 predicted 1027
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024172 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00327478 predicted 786
2 SASI_Mm02_00327479 predicted 1051
3 SASI_Mm01_00191571 predicted 337
4 SASI_Mm02_00327480 predicted 654
5 SASI_Mm01_00191572 predicted 673
6 SASI_Mm01_00191573 predicted 1181
7 SASI_Mm01_00191574 predicted 472
8 SASI_Mm01_00191576 predicted 902
9 SASI_Mm01_00191577 predicted 883
10 SASI_Mm01_00191579 predicted 1222
11 SASI_Mm01_00191570 predicted 656
12 SASI_Mm01_00191575 predicted 905
13 SASI_Mm01_00191578 predicted 795
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012267
VALIDATED
HSPBP1 MISSION shRNA Bacterial Glycerol Stock
HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012267.2-1626s1c1
Sequence:CCGGGCTCTTCCAATAAAGGTGTTTCTCGAGAAACACCTTTATTGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012267.2-1058s1c1
Sequence:CCGGCAAGGTCAAATCAGCATTCCTCTCGAGAGGAATGCTGATTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012267.2-1619s1c1
Sequence:CCGGCCACACAGCTCTTCCAATAAACTCGAGTTTATTGGAAGAGCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-832s21c1
Sequence:CCGGTGTGTGAGAACATGGACAATGCTCGAGCATTGTCCATGTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012267.4-1741s21c1
Sequence:CCGGTCCACACAGCTCTTCCAATAACTCGAGTTATTGGAAGAGCTGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-1179s21c1
Sequence:CCGGCTCAAGGTCAAATCAGCATTCCTCGAGGAATGCTGATTTGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-1471s21c1
Sequence:CCGGAGCTGCTACAGACCTGTTTCTCTCGAGAGAAACAGGTCTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012267.4-1506s21c1
Sequence:CCGGGACAGCATGGATCGGTGAAACCTCGAGGTTTCACCGATCCATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012267
VALIDATED
HSPBP1 MISSION shRNA shRNA Plasmid DNA
HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012267.2-1626s1c1
Sequence:CCGGGCTCTTCCAATAAAGGTGTTTCTCGAGAAACACCTTTATTGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012267.2-1058s1c1
Sequence:CCGGCAAGGTCAAATCAGCATTCCTCTCGAGAGGAATGCTGATTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012267.2-1619s1c1
Sequence:CCGGCCACACAGCTCTTCCAATAAACTCGAGTTTATTGGAAGAGCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-832s21c1
Sequence:CCGGTGTGTGAGAACATGGACAATGCTCGAGCATTGTCCATGTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012267.4-1741s21c1
Sequence:CCGGTCCACACAGCTCTTCCAATAACTCGAGTTATTGGAAGAGCTGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-1179s21c1
Sequence:CCGGCTCAAGGTCAAATCAGCATTCCTCGAGGAATGCTGATTTGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-1471s21c1
Sequence:CCGGAGCTGCTACAGACCTGTTTCTCTCGAGAGAAACAGGTCTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012267.4-1506s21c1
Sequence:CCGGGACAGCATGGATCGGTGAAACCTCGAGGTTTCACCGATCCATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012267
VALIDATED
HSPBP1 MISSION shRNA Lentiviral Transduction Particles
HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183361    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012267.2-1626s1c1
Sequence:CCGGGCTCTTCCAATAAAGGTGTTTCTCGAGAAACACCTTTATTGGAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178954    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012267.2-1058s1c1
Sequence:CCGGCAAGGTCAAATCAGCATTCCTCTCGAGAGGAATGCTGATTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179070    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012267.2-1619s1c1
Sequence:CCGGCCACACAGCTCTTCCAATAAACTCGAGTTTATTGGAAGAGCTGTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-832s21c1
Sequence:CCGGTGTGTGAGAACATGGACAATGCTCGAGCATTGTCCATGTTCTCACACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244157    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_012267.4-1741s21c1
Sequence:CCGGTCCACACAGCTCTTCCAATAACTCGAGTTATTGGAAGAGCTGTGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244159    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-1179s21c1
Sequence:CCGGCTCAAGGTCAAATCAGCATTCCTCGAGGAATGCTGATTTGACCTTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244158    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_012267.4-1471s21c1
Sequence:CCGGAGCTGCTACAGACCTGTTTCTCTCGAGAGAAACAGGTCTGTAGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244156    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012267.4-1506s21c1
Sequence:CCGGGACAGCATGGATCGGTGAAACCTCGAGGTTTCACCGATCCATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024172
HSPBP1 MISSION shRNA Bacterial Glycerol Stock
HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000190164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024172.2-896s1c1
Sequence:CCGGCAAGGTCAAGTCAGCATTCCTCTCGAGAGGAATGCTGACTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024172.2-950s1c1
Sequence:CCGGCAAAGGAACCCTTTGCTCCATCTCGAGATGGAGCAAAGGGTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-547s21c1
Sequence:CCGGTGTGCGAGAACATGGACAATGCTCGAGCATTGTCCATGTTCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-1066s21c1
Sequence:CCGGTCCCTCAGGGTGTTCGTGAATCTCGAGATTCACGAACACCCTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-662s21c1
Sequence:CCGGCATCGGCACATGCAGTCAGAACTCGAGTTCTGACTGCATGTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-299s21c1
Sequence:CCGGCCTGCTGCAGATGGCTATTACCTCGAGGTAATAGCCATCTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024172.3-1302s21c1
Sequence:CCGGGGCACTCTCTCTTAAGGGATTCTCGAGAATCCCTTAAGAGAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024172
HSPBP1 MISSION shRNA shRNA Plasmid DNA
HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000190164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024172.2-896s1c1
Sequence:CCGGCAAGGTCAAGTCAGCATTCCTCTCGAGAGGAATGCTGACTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024172.2-950s1c1
Sequence:CCGGCAAAGGAACCCTTTGCTCCATCTCGAGATGGAGCAAAGGGTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-547s21c1
Sequence:CCGGTGTGCGAGAACATGGACAATGCTCGAGCATTGTCCATGTTCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-1066s21c1
Sequence:CCGGTCCCTCAGGGTGTTCGTGAATCTCGAGATTCACGAACACCCTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-662s21c1
Sequence:CCGGCATCGGCACATGCAGTCAGAACTCGAGTTCTGACTGCATGTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-299s21c1
Sequence:CCGGCCTGCTGCAGATGGCTATTACCTCGAGGTAATAGCCATCTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024172.3-1302s21c1
Sequence:CCGGGGCACTCTCTCTTAAGGGATTCTCGAGAATCCCTTAAGAGAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024172
HSPBP1 MISSION shRNA Lentiviral Transduction Particles
HSPA (heat shock 70kDa) binding protein, cytoplasmic cochaperone 1
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000190164    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024172.2-896s1c1
Sequence:CCGGCAAGGTCAAGTCAGCATTCCTCTCGAGAGGAATGCTGACTTGACCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189645    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024172.2-950s1c1
Sequence:CCGGCAAAGGAACCCTTTGCTCCATCTCGAGATGGAGCAAAGGGTTCCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-547s21c1
Sequence:CCGGTGTGCGAGAACATGGACAATGCTCGAGCATTGTCCATGTTCTCGCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246668    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-1066s21c1
Sequence:CCGGTCCCTCAGGGTGTTCGTGAATCTCGAGATTCACGAACACCCTGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246665    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-662s21c1
Sequence:CCGGCATCGGCACATGCAGTCAGAACTCGAGTTCTGACTGCATGTGCCGATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024172.3-299s21c1
Sequence:CCGGCCTGCTGCAGATGGCTATTACCTCGAGGTAATAGCCATCTGCAGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246667    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024172.3-1302s21c1
Sequence:CCGGGGCACTCTCTCTTAAGGGATTCTCGAGAATCCCTTAAGAGAGAGTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks