EMAIL THIS PAGE TO A FRIEND

HSPG2

heparan sulfate proteoglycan 2

Synonyms: HSPG PLC PRCAN SJA SJS SJS1
UniProtKB ID: P98160, Q16287, Q5SZI3, Q9H3V5
Gene ID:
Human(3339) Summary: This gene encodes the perlecan protein, which consists of a core protein to which three long chains of glycosaminoglycans (heparan sulfate or chondroitin sulfate) are attached. The perlecan protein is a large multidomain proteoglycan that binds to and cross-links many extracellular matrix components and cell-surface molecules. It has been shown that this protein interacts with laminin, prolargin, collagen type IV, FGFBP1, FBLN2, FGF7 and Transthyretin, etc. and plays essential roles in multiple biological activities. Perlecan is a key component of the vascular extracellular matrix, where it helps to maintain the endothelial barrier function. It is a potent inhibitor of smooth muscle cell proliferation and is thus thought to help maintain vascular homeostasis. It can also promote growth factor (e.g., FGF2) activity and thus stimulate endothelial growth and re-generation. It is a major component of basement membranes, where it is involved in the stabilization of other molecules as well as being involved with glomerular permeability to macromolecules and cell adhesion. Mutations in this gene cause Schwartz-Jampel syndrome type 1, Silverman-Handmaker type of dyssegmental dysplasia, and Tardive dyskinesia.[provided by RefSeq, Mar 2010]
Mouse(15530) perlecan (heparan sulfate proteoglycan 2)
Rat(117511) heparan sulfate proteoglycan 2
Zebrafish(565429) heparan sulfate proteoglycan 2
cow(444872) heparan sulfate proteoglycan 2
Horse(100071701) heparan sulfate proteoglycan 2
domestic cat(101094520) heparan sulfate proteoglycan 2
dog(403440) heparan sulfate proteoglycan 2
chicken(429806) heparan sulfate proteoglycan 2
sheep(101122677) heparan sulfate proteoglycan 2
Domestic Rabbit(100340334) heparan sulfate proteoglycan 2
sheep(100294588) heparan sulfate proteoglycan 2
domestic guinea pig(100718406) heparan sulfate proteoglycan 2
naked mole-rat(101700294) heparan sulfate proteoglycan 2
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB4301218 Anti-HSPG2 antibody produced in rabbit affinity isolated antibody mouse, human
immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005529 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005529 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005529 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008305 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008305 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008305 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005529 Rosetta Predictions human pricing
NM_008305 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005529 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00032360 predicted 9512
2 SASI_Hs01_00032361 predicted 3134
3 SASI_Hs01_00032362 predicted 1881
4 SASI_Hs01_00032363 predicted 717
5 SASI_Hs01_00032364 predicted 5284
6 SASI_Hs01_00032365 predicted 717
7 SASI_Hs01_00032366 predicted 9566
8 SASI_Hs01_00032367 predicted 12123
9 SASI_Hs01_00032368 predicted 2152
10 SASI_Hs02_00339756 predicted 1078
11 SASI_Hs01_00032359 predicted 8116
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008305 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313603 predicted 6238
2 SASI_Mm02_00313604 predicted 12167
3 SASI_Mm02_00313605 predicted 6742
4 SASI_Mm02_00313606 predicted 7259
5 SASI_Mm02_00313607 predicted 8415
6 SASI_Mm02_00313608 predicted 6163
7 SASI_Mm02_00313609 predicted 1898
8 SASI_Mm02_00313610 predicted 12272
9 SASI_Mm02_00313611 predicted 9866
10 SASI_Mm02_00313612 predicted 11338
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005529
HSPG2 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate proteoglycan 2
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000413420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005529.5-10416s21c1
Sequence:CCGGGCTGCCAAGGGACGTATATATCTCGAGATATATACGTCCCTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-6201s1c1
Sequence:CCGGCGGTCAAGATTGAGTCCTCATCTCGAGATGAGGACTCAATCTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-5291s1c1
Sequence:CCGGCGTAATCTCCACCGATCCAATCTCGAGATTGGATCGGTGGAGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-180s1c1
Sequence:CCGGGCTGGACACATTCGTACCTTTCTCGAGAAAGGTACGAATGTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-8017s1c1
Sequence:CCGGCCAGGCTATCATCACATGGTACTCGAGTACCATGTGATGATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-3139s1c1
Sequence:CCGGGCTGCAAGGTAACAACATCATCTCGAGATGATGTTGTTACCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005529
HSPG2 MISSION shRNA shRNA Plasmid DNA
heparan sulfate proteoglycan 2
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000413420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005529.5-10416s21c1
Sequence:CCGGGCTGCCAAGGGACGTATATATCTCGAGATATATACGTCCCTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-6201s1c1
Sequence:CCGGCGGTCAAGATTGAGTCCTCATCTCGAGATGAGGACTCAATCTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-5291s1c1
Sequence:CCGGCGTAATCTCCACCGATCCAATCTCGAGATTGGATCGGTGGAGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-180s1c1
Sequence:CCGGGCTGGACACATTCGTACCTTTCTCGAGAAAGGTACGAATGTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-8017s1c1
Sequence:CCGGCCAGGCTATCATCACATGGTACTCGAGTACCATGTGATGATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-3139s1c1
Sequence:CCGGGCTGCAAGGTAACAACATCATCTCGAGATGATGTTGTTACCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005529
HSPG2 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate proteoglycan 2
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000413420    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005529.5-10416s21c1
Sequence:CCGGGCTGCCAAGGGACGTATATATCTCGAGATATATACGTCCCTTGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073568    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-6201s1c1
Sequence:CCGGCGGTCAAGATTGAGTCCTCATCTCGAGATGAGGACTCAATCTTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073572    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-5291s1c1
Sequence:CCGGCGTAATCTCCACCGATCCAATCTCGAGATTGGATCGGTGGAGATTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073571    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-180s1c1
Sequence:CCGGGCTGGACACATTCGTACCTTTCTCGAGAAAGGTACGAATGTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073569    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-8017s1c1
Sequence:CCGGCCAGGCTATCATCACATGGTACTCGAGTACCATGTGATGATAGCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073570    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005529.2-3139s1c1
Sequence:CCGGGCTGCAAGGTAACAACATCATCTCGAGATGATGTTGTTACCTTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008305
VALIDATED
HSPG2 MISSION shRNA Bacterial Glycerol Stock
heparan sulfate proteoglycan 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-12561s21c1
Sequence:CCGGTGCCAACAAGGCGCTGGATATCTCGAGATATCCAGCGCCTTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-4361s21c1
Sequence:CCGGTATCCAGATTACGGGCAATAACTCGAGTTATTGCCCGTAATCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-4084s21c1
Sequence:CCGGAGCTGATCTCTACCCACTTTGCTCGAGCAAAGTGGGTAGAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-13250s21c1
Sequence:CCGGAGCCTGACAGTGTCGAGTATACTCGAGTATACTCGACACTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-11230s21c1
Sequence:CCGGGAAGGCCTGAGTTTCGATTTGCTCGAGCAAATCGAAACTCAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008305
VALIDATED
HSPG2 MISSION shRNA shRNA Plasmid DNA
heparan sulfate proteoglycan 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-12561s21c1
Sequence:CCGGTGCCAACAAGGCGCTGGATATCTCGAGATATCCAGCGCCTTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-4361s21c1
Sequence:CCGGTATCCAGATTACGGGCAATAACTCGAGTTATTGCCCGTAATCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-4084s21c1
Sequence:CCGGAGCTGATCTCTACCCACTTTGCTCGAGCAAAGTGGGTAGAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-13250s21c1
Sequence:CCGGAGCCTGACAGTGTCGAGTATACTCGAGTATACTCGACACTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-11230s21c1
Sequence:CCGGGAAGGCCTGAGTTTCGATTTGCTCGAGCAAATCGAAACTCAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008305
VALIDATED
HSPG2 MISSION shRNA Lentiviral Transduction Particles
heparan sulfate proteoglycan 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257584    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-12561s21c1
Sequence:CCGGTGCCAACAAGGCGCTGGATATCTCGAGATATCCAGCGCCTTGTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246980    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-4361s21c1
Sequence:CCGGTATCCAGATTACGGGCAATAACTCGAGTTATTGCCCGTAATCTGGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246982    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-4084s21c1
Sequence:CCGGAGCTGATCTCTACCCACTTTGCTCGAGCAAAGTGGGTAGAGATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246981    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-13250s21c1
Sequence:CCGGAGCCTGACAGTGTCGAGTATACTCGAGTATACTCGACACTGTCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257750    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_008305.3-11230s21c1
Sequence:CCGGGAAGGCCTGAGTTTCGATTTGCTCGAGCAAATCGAAACTCAGGCCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks