EMAIL THIS PAGE TO A FRIEND

HTR2C

5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled

Synonyms: 5-HT2C 5-HTR2C HTR1C
UniProtKB ID: P28335, B1AMW4, Q5VUF8, Q9NP28
Gene ID:
Human(3358) Summary: Serotonin (5-hydroxytryptamine, 5-HT), a neurotransmitter, elicits a wide array of physiological effects by binding to several receptor subtypes, including the 5-HT2 family of seven-transmembrane-spanning, G-protein-coupled receptors, which activate phospholipase C and D signaling pathways. This gene encodes the 2C subtype of serotonin receptor and its mRNA is subject to multiple RNA editing events, where genomically encoded adenosine residues are converted to inosines. RNA editing is predicted to alter amino acids within the second intracellular loop of the 5-HT2C receptor and generate receptor isoforms that differ in their ability to interact with G proteins and the activation of phospholipase C and D signaling cascades, thus modulating serotonergic neurotransmission in the central nervous system. Studies in humans have reported abnormalities in patterns of 5-HT2C editing in depressed suicide victims. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Feb 2012]
Mouse(15560) 5-hydroxytryptamine (serotonin) receptor 2C
Rat(25187) 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
naked mole-rat(101726296) 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
chicken(428707) 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
cow(538909) 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
Horse(100057852) 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
domestic cat(101099620) 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
dog(450240) 5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
308 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Allosteric Modulator

Product # Description Species Add to Cart
 
D9190 DCEBIO ≥98% (HPLC), solid human pricing

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P0884 (±)-Propranolol hydrochloride ≥99% (TLC), powder human pricing
S003 1-(1-Naphthyl)piperazine hydrochloride needles human pricing
C4542 Cyclobenzaprine hydrochloride human pricing
C6022 Cyproheptadine hydrochloride sesquihydrate ≥98% (TLC), solid human pricing
S006 Ketanserin (+)-tartrate salt ≥97%, solid human pricing
M137 Methysergide maleate salt solid human pricing
O111 Octoclothepin maleate salt solid human pricing
P126 Pirenperone >97%, solid human pricing
S180 SB-206553 hydrochloride hydrate ≥98% (HPLC), solid human pricing
M0443 Mirtazapine ≥98% (HPLC) human, mouse, rat pricing
38827 4,4′-Dimethoxytriphenylmethyl chloride ≥97.0% (HPLC) human, rat pricing
C117 5-Carboxamidotryptamine maleate salt powder, ≥98% (HPLC) human, rat pricing
286583 5-Methoxytryptamine 97% human, rat pricing
M1626 6-Methoxyharmalan crystalline human, rat pricing
C6305 Clozapine human, rat pricing
H1512 Haloperidol powder human, rat pricing
51330 Harmaline human, rat pricing
L7007 Lysergic acid diethylamide human, rat pricing
M3668 Metergoline human, rat pricing
65372 O-Methylserotonin purum, ≥98.0% (NT) human, rat pricing
P2279 Psilocin human, rat pricing
P4054 Psilocin solution 100 μg/mL in methanol, drug standard human, rat pricing
S0693 SB 204741 >98% (HPLC) human, rat pricing
S7395 Spiperone solid human, rat pricing
300764 1,2,3,4-Tetrahydro-9H-pyrido[3,4-b]indole 98% rat pricing
571083 1-Benzoylpiperazine 97% rat pricing
13815 1-Benzylpiperazine ≥97.0% (GC) rat pricing
79224 1-Phenyl-1,3,8-triazaspiro[4.5]decan-4-one ≥96.0% (HPLC) rat pricing
357677 2,5-Dimethoxyphenethylamine 97% rat pricing
476021 2-Methoxyphenethylamine 98% rat pricing
142360 4-Benzylpiperidine 99% rat pricing
291552 6-Methoxy-1,2,3,4-tetrahydro-9H-pyrido[3,4-b]indole 97% rat pricing
610240 DL-Amphetamine solution 1 mg/mL in methanol, drug standard rat pricing

Small Molecule - Metabolite

Product # Description Species Add to Cart
 
H8876 5-Hydroxyindole-3-acetic acid ≥98% (HPLC), crystalline human pricing

Small Molecule - Mixed Agonist/Antagonist

Product # Description Species Add to Cart
 
M2381 5-Methoxy-N,N-dimethyltryptamine human, rat pricing

Small Molecule - Precursor

Product # Description Species Add to Cart
 
H9772 5-Hydroxy-L-tryptophan powder human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000868 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000868 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000868 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008312 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008312 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008312 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU120291 MISSION® esiRNA esiRNA human HTR2C (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000868 Rosetta Predictions human pricing
NM_012765 Rosetta Predictions rat pricing
NM_008312 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000868 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303397 predicted 1178
2 SASI_Hs01_00236441 predicted 817
3 SASI_Hs02_00303398 predicted 1868
4 SASI_Hs01_00236442 predicted 936
5 SASI_Hs01_00236443 predicted 1980
6 SASI_Hs01_00236444 predicted 1158
7 SASI_Hs01_00236445 predicted 1422
8 SASI_Hs01_00236446 predicted 2087
9 SASI_Hs01_00236447 predicted 1869
10 SASI_Hs01_00236448 predicted 1196
11 SASI_Hs01_00236449 predicted 1246
12 SASI_Hs01_00236450 predicted 2050
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012765 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00120730 predicted 629
2 SASI_Rn02_00260139 predicted 1749
3 SASI_Rn01_00120731 predicted 777
4 SASI_Rn01_00120732 predicted 603
5 SASI_Rn01_00120734 predicted 1072
6 SASI_Rn01_00120735 predicted 1402
7 SASI_Rn02_00260140 predicted 579
8 SASI_Rn01_00120736 predicted 828
9 SASI_Rn01_00120739 predicted 1304
10 SASI_Rn02_00260141 predicted 1581
11 SASI_Rn01_00120733 predicted 595
12 SASI_Rn01_00120737 predicted 779
13 SASI_Rn01_00120738 predicted 774
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008312 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00165300 predicted 979
2 SASI_Mm01_00165301 predicted 940
3 SASI_Mm02_00313623 predicted 1126
4 SASI_Mm01_00165302 predicted 776
5 SASI_Mm01_00165304 predicted 943
6 SASI_Mm02_00313624 predicted 1836
7 SASI_Mm02_00313625 predicted 855
8 SASI_Mm02_00313626 predicted 1143
9 SASI_Mm01_00165305 predicted 1723
10 SASI_Mm01_00165307 predicted 1650
11 SASI_Mm01_00165303 predicted 870
12 SASI_Mm01_00165306 predicted 1180
13 SASI_Mm01_00165308 predicted 1736
14 SASI_Mm01_00165309 predicted 1146
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000868
HTR2C MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1871s21c1
Sequence:CCGGCTATTTGCGTTGCAATTATAACTCGAGTTATAATTGCAACGCAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000357445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1397s21c1
Sequence:CCGGCTTCATACCGCTGACGATTATCTCGAGATAATCGTCAGCGGTATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1153s21c1
Sequence:CCGGTCATGCACCTCTGCGCTATATCTCGAGATATAGCGCAGAGGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000868.1-3359s1c1
Sequence:CCGGGCAGTTATTTACCAGAAGTTTCTCGAGAAACTTCTGGTAAATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-897s1c1
Sequence:CCGGGCACTTTCAATCGTCATCATACTCGAGTATGATGACGATTGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-2022s1c1
Sequence:CCGGCCCGGTATAGAGATGCAAGTTCTCGAGAACTTGCATCTCTATACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-1217s1c1
Sequence:CCGGCCGTTTCAATTCGCGGACTAACTCGAGTTAGTCCGCGAATTGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000009102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-1404s1c1
Sequence:CCGGCCGCTGACGATTATGGTGATTCTCGAGAATCACCATAATCGTCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000868
HTR2C MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1871s21c1
Sequence:CCGGCTATTTGCGTTGCAATTATAACTCGAGTTATAATTGCAACGCAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000357445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1397s21c1
Sequence:CCGGCTTCATACCGCTGACGATTATCTCGAGATAATCGTCAGCGGTATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1153s21c1
Sequence:CCGGTCATGCACCTCTGCGCTATATCTCGAGATATAGCGCAGAGGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000868.1-3359s1c1
Sequence:CCGGGCAGTTATTTACCAGAAGTTTCTCGAGAAACTTCTGGTAAATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-897s1c1
Sequence:CCGGGCACTTTCAATCGTCATCATACTCGAGTATGATGACGATTGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-2022s1c1
Sequence:CCGGCCCGGTATAGAGATGCAAGTTCTCGAGAACTTGCATCTCTATACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-1217s1c1
Sequence:CCGGCCGTTTCAATTCGCGGACTAACTCGAGTTAGTCCGCGAATTGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000009102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-1404s1c1
Sequence:CCGGCCGCTGACGATTATGGTGATTCTCGAGAATCACCATAATCGTCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000868
HTR2C MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378358    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1871s21c1
Sequence:CCGGCTATTTGCGTTGCAATTATAACTCGAGTTATAATTGCAACGCAAATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000357445    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1397s21c1
Sequence:CCGGCTTCATACCGCTGACGATTATCTCGAGATAATCGTCAGCGGTATGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378251    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000868.2-1153s21c1
Sequence:CCGGTCATGCACCTCTGCGCTATATCTCGAGATATAGCGCAGAGGTGCATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009098    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000868.1-3359s1c1
Sequence:CCGGGCAGTTATTTACCAGAAGTTTCTCGAGAAACTTCTGGTAAATAACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-897s1c1
Sequence:CCGGGCACTTTCAATCGTCATCATACTCGAGTATGATGACGATTGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-2022s1c1
Sequence:CCGGCCCGGTATAGAGATGCAAGTTCTCGAGAACTTGCATCTCTATACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-1217s1c1
Sequence:CCGGCCGTTTCAATTCGCGGACTAACTCGAGTTAGTCCGCGAATTGAAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000009102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000868.1-1404s1c1
Sequence:CCGGCCGCTGACGATTATGGTGATTCTCGAGAATCACCATAATCGTCAGCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008312
HTR2C MISSION shRNA Bacterial Glycerol Stock
5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1942s1c1
Sequence:CCGGCGGCATACCAATGAACGTGTACTCGAGTACACGTTCATTGGTATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-2049s1c1
Sequence:CCGGCGAGAGGATTAGTAGTGTGTACTCGAGTACACACTACTAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-862s1c1
Sequence:CCGGGCACTTTCAATAGTCGTGATTCTCGAGAATCACGACTATTGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1618s1c1
Sequence:CCGGGCTTCCAAAGTCCTTGGCATTCTCGAGAATGCCAAGGACTTTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1368s1c1
Sequence:CCGGCCCGTTGACAATTATGGTGATCTCGAGATCACCATAATTGTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008312
HTR2C MISSION shRNA shRNA Plasmid DNA
5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1942s1c1
Sequence:CCGGCGGCATACCAATGAACGTGTACTCGAGTACACGTTCATTGGTATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-2049s1c1
Sequence:CCGGCGAGAGGATTAGTAGTGTGTACTCGAGTACACACTACTAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-862s1c1
Sequence:CCGGGCACTTTCAATAGTCGTGATTCTCGAGAATCACGACTATTGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1618s1c1
Sequence:CCGGGCTTCCAAAGTCCTTGGCATTCTCGAGAATGCCAAGGACTTTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1368s1c1
Sequence:CCGGCCCGTTGACAATTATGGTGATCTCGAGATCACCATAATTGTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008312
HTR2C MISSION shRNA Lentiviral Transduction Particles
5-hydroxytryptamine (serotonin) receptor 2C, G protein-coupled
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027485    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1942s1c1
Sequence:CCGGCGGCATACCAATGAACGTGTACTCGAGTACACGTTCATTGGTATGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027492    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-2049s1c1
Sequence:CCGGCGAGAGGATTAGTAGTGTGTACTCGAGTACACACTACTAATCCTCTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027416    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-862s1c1
Sequence:CCGGGCACTTTCAATAGTCGTGATTCTCGAGAATCACGACTATTGAAAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1618s1c1
Sequence:CCGGGCTTCCAAAGTCCTTGGCATTCTCGAGAATGCCAAGGACTTTGGAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027426    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008312.2-1368s1c1
Sequence:CCGGCCCGTTGACAATTATGGTGATCTCGAGATCACCATAATTGTCAACGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks