EMAIL THIS PAGE TO A FRIEND

HUNK

hormonally up-regulated Neu-associated kinase

UniProtKB ID: P57058
Gene ID:
Mouse(26559) hormonally upregulated Neu-associated kinase
Rat(288275) hormonally upregulated Neu-associated kinase
Zebrafish(564235) hormonally up-regulated Neu-associated kinase
dog(487733) hormonally up-regulated Neu-associated kinase
cow(537640) hormonally up-regulated Neu-associated kinase
domestic cat(101094041) hormonally up-regulated Neu-associated kinase
chicken(418493) hormonally up-regulated Neu-associated kinase
sheep(101114080) hormonally up-regulated Neu-associated kinase
domestic guinea pig(100718576) hormonally up-regulated Neu-associated kinase
naked mole-rat(101715055) hormonally up-regulated Neu-associated kinase
146 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014586 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014586 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014586 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_015755 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_015755 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_015755 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014586 siRNAs that have been validated in the lab human pricing
XM_001073106 Rosetta Predictions rat pricing
XM_221671 Rosetta Predictions rat pricing
NM_015755 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014586 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081235 validated 1142
2 SASI_Hs02_00345863 predicted 2446
3 SASI_Hs01_00081237 predicted 1273
4 SASI_Hs01_00081238 predicted 2347
5 SASI_Hs01_00081239 predicted 763
6 SASI_Hs01_00081240 predicted 1512
7 SASI_Hs01_00081241 predicted 2538
8 SASI_Hs02_00345864 predicted 1343
9 SASI_Hs01_00081242 predicted 1278
10 SASI_Hs02_00345865 predicted 847
11 SASI_Hs01_00081234 predicted 960
12 SASI_Hs01_00081236 predicted 1110
13 SASI_Hs01_00081243 predicted 2199
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001073106 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00341524 predicted 1458
2 SASI_Rn02_00341525 predicted 1128
3 SASI_Rn02_00341526 predicted 2008
4 SASI_Rn02_00341527 predicted 1432
5 SASI_Rn02_00341528 predicted 2624
6 SASI_Rn02_00341529 predicted 1921
7 SASI_Rn02_00341530 predicted 1656
8 SASI_Rn02_00341531 predicted 1855
9 SASI_Rn02_00341532 predicted 1419
10 SASI_Rn02_00341533 predicted 2364
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_221671 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00380291 predicted 1503
2 SASI_Rn02_00380292 predicted 1712
3 SASI_Rn02_00380293 predicted 1530
4 SASI_Rn02_00380294 predicted 1208
5 SASI_Rn02_00380295 predicted 425
6 SASI_Rn02_00380296 predicted 460
7 SASI_Rn02_00380297 predicted 1511
8 SASI_Rn02_00380298 predicted 1335
9 SASI_Rn02_00380299 predicted 1496
10 SASI_Rn02_00380300 predicted 1110
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015755 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00163716 predicted 659
2 SASI_Mm01_00163717 predicted 626
3 SASI_Mm01_00163718 predicted 1828
4 SASI_Mm01_00163719 predicted 1480
5 SASI_Mm02_00323086 predicted 1539
6 SASI_Mm01_00163720 predicted 1123
7 SASI_Mm02_00323087 predicted 1732
8 SASI_Mm01_00163721 predicted 1653
9 SASI_Mm01_00163723 predicted 1302
10 SASI_Mm01_00163724 predicted 621
11 SASI_Mm01_00163715 predicted 1435
12 SASI_Mm01_00163722 predicted 1250
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014586
HUNK MISSION shRNA Bacterial Glycerol Stock
hormonally up-regulated Neu-associated kinase
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000199252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014586.1-2455s1c1
Sequence:CCGGCCTGTGAACCTTGCCTTTGACCTCGAGGTCAAAGGCAAGGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-1103s1c1
Sequence:CCGGCCATAGGTGTGAACATGTATGCTCGAGCATACATGTTCACACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-801s1c1
Sequence:CCGGCCTGATGCACAAGATCTATGACTCGAGTCATAGATCTTGTGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.1-4903s1c1
Sequence:CCGGGACTCTGAACTCAGGTTTATTCTCGAGAATAAACCTGAGTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-924s1c1
Sequence:CCGGGATAGAGAATTTGCTACTAGACTCGAGTCTAGTAGCAAATTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.1-6820s1c1
Sequence:CCGGGCCTGTTGGTTAGTGTATTTACTCGAGTAAATACACTAACCAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1764s1c1
Sequence:CCGGAGGCTCGCTTATGACACAGATCTCGAGATCTGTGTCATAAGCGAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.x-3381s1c1
Sequence:CCGGCCTGTGTTCATCCTGTTGTTTCTCGAGAAACAACAGGATGAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1183s1c1
Sequence:CCGGCAGAAGATGGTAGACAAAGAACTCGAGTTCTTTGTCTACCATCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1347s1c1
Sequence:CCGGCTGTAATGTCACCTATCCCAACTCGAGTTGGGATAGGTGACATTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000002268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-721s1c1
Sequence:CCGGCCCAATATCACTCAGCTCCTTCTCGAGAAGGAGCTGAGTGATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014586
HUNK MISSION shRNA shRNA Plasmid DNA
hormonally up-regulated Neu-associated kinase
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000199252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014586.1-2455s1c1
Sequence:CCGGCCTGTGAACCTTGCCTTTGACCTCGAGGTCAAAGGCAAGGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-1103s1c1
Sequence:CCGGCCATAGGTGTGAACATGTATGCTCGAGCATACATGTTCACACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-801s1c1
Sequence:CCGGCCTGATGCACAAGATCTATGACTCGAGTCATAGATCTTGTGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.1-4903s1c1
Sequence:CCGGGACTCTGAACTCAGGTTTATTCTCGAGAATAAACCTGAGTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-924s1c1
Sequence:CCGGGATAGAGAATTTGCTACTAGACTCGAGTCTAGTAGCAAATTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.1-6820s1c1
Sequence:CCGGGCCTGTTGGTTAGTGTATTTACTCGAGTAAATACACTAACCAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1764s1c1
Sequence:CCGGAGGCTCGCTTATGACACAGATCTCGAGATCTGTGTCATAAGCGAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.x-3381s1c1
Sequence:CCGGCCTGTGTTCATCCTGTTGTTTCTCGAGAAACAACAGGATGAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1183s1c1
Sequence:CCGGCAGAAGATGGTAGACAAAGAACTCGAGTTCTTTGTCTACCATCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1347s1c1
Sequence:CCGGCTGTAATGTCACCTATCCCAACTCGAGTTGGGATAGGTGACATTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000002268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-721s1c1
Sequence:CCGGCCCAATATCACTCAGCTCCTTCTCGAGAAGGAGCTGAGTGATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014586
HUNK MISSION shRNA Lentiviral Transduction Particles
hormonally up-regulated Neu-associated kinase
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000199252    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014586.1-2455s1c1
Sequence:CCGGCCTGTGAACCTTGCCTTTGACCTCGAGGTCAAAGGCAAGGTTCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195335    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-1103s1c1
Sequence:CCGGCCATAGGTGTGAACATGTATGCTCGAGCATACATGTTCACACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-801s1c1
Sequence:CCGGCCTGATGCACAAGATCTATGACTCGAGTCATAGATCTTGTGCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196439    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.1-4903s1c1
Sequence:CCGGGACTCTGAACTCAGGTTTATTCTCGAGAATAAACCTGAGTTCAGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196527    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.1-924s1c1
Sequence:CCGGGATAGAGAATTTGCTACTAGACTCGAGTCTAGTAGCAAATTCTCTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196737    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.1-6820s1c1
Sequence:CCGGGCCTGTTGGTTAGTGTATTTACTCGAGTAAATACACTAACCAACAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002267    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1764s1c1
Sequence:CCGGAGGCTCGCTTATGACACAGATCTCGAGATCTGTGTCATAAGCGAGCCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002271    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_014586.x-3381s1c1
Sequence:CCGGCCTGTGTTCATCCTGTTGTTTCTCGAGAAACAACAGGATGAACACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002270    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1183s1c1
Sequence:CCGGCAGAAGATGGTAGACAAAGAACTCGAGTTCTTTGTCTACCATCTTCTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002269    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-1347s1c1
Sequence:CCGGCTGTAATGTCACCTATCCCAACTCGAGTTGGGATAGGTGACATTACAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000002268    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014586.x-721s1c1
Sequence:CCGGCCCAATATCACTCAGCTCCTTCTCGAGAAGGAGCTGAGTGATATTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015755
VALIDATED
HUNK MISSION shRNA Bacterial Glycerol Stock
hormonally up-regulated Neu-associated kinase
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-1244s1c1
Sequence:CCGGCCAAGATAGCATCTGCTACAACTCGAGTTGTAGCAGATGCTATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-1888s1c1
Sequence:CCGGCTCTCCAAACTCCACTGCATTCTCGAGAATGCAGTGGAGTTTGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015755.1-1644s1c1
Sequence:CCGGCCAAGGATTGTAAAGAAACTACTCGAGTAGTTTCTTTACAATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-698s1c1
Sequence:CCGGCCTAGGTTACTCGGATCCATTCTCGAGAATGGATCCGAGTAACCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015755.1-458s1c1
Sequence:CCGGGAACAGCTACTACCTGGTCATCTCGAGATGACCAGGTAGTAGCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-323s21c1
Sequence:CCGGAGCTATCAAGGTCATCGATAACTCGAGTTATCGATGACCTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-971s21c1
Sequence:CCGGCCCTGTGAAGAGGCCGAATATCTCGAGATATTCGGCCTCTTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-1205s21c1
Sequence:CCGGCAAGAAACTTGAGCGCTATTTCTCGAGAAATAGCGCTCAAGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-1264s21c1
Sequence:CCGGAGACCCAGCTCTACCAGATAGCTCGAGCTATCTGGTAGAGCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015755
VALIDATED
HUNK MISSION shRNA shRNA Plasmid DNA
hormonally up-regulated Neu-associated kinase
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-1244s1c1
Sequence:CCGGCCAAGATAGCATCTGCTACAACTCGAGTTGTAGCAGATGCTATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-1888s1c1
Sequence:CCGGCTCTCCAAACTCCACTGCATTCTCGAGAATGCAGTGGAGTTTGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015755.1-1644s1c1
Sequence:CCGGCCAAGGATTGTAAAGAAACTACTCGAGTAGTTTCTTTACAATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-698s1c1
Sequence:CCGGCCTAGGTTACTCGGATCCATTCTCGAGAATGGATCCGAGTAACCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015755.1-458s1c1
Sequence:CCGGGAACAGCTACTACCTGGTCATCTCGAGATGACCAGGTAGTAGCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-323s21c1
Sequence:CCGGAGCTATCAAGGTCATCGATAACTCGAGTTATCGATGACCTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-971s21c1
Sequence:CCGGCCCTGTGAAGAGGCCGAATATCTCGAGATATTCGGCCTCTTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-1205s21c1
Sequence:CCGGCAAGAAACTTGAGCGCTATTTCTCGAGAAATAGCGCTCAAGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-1264s21c1
Sequence:CCGGAGACCCAGCTCTACCAGATAGCTCGAGCTATCTGGTAGAGCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015755
VALIDATED
HUNK MISSION shRNA Lentiviral Transduction Particles
hormonally up-regulated Neu-associated kinase
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024230    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-1244s1c1
Sequence:CCGGCCAAGATAGCATCTGCTACAACTCGAGTTGTAGCAGATGCTATCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024231    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-1888s1c1
Sequence:CCGGCTCTCCAAACTCCACTGCATTCTCGAGAATGCAGTGGAGTTTGGAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015755.1-1644s1c1
Sequence:CCGGCCAAGGATTGTAAAGAAACTACTCGAGTAGTTTCTTTACAATCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_015755.1-698s1c1
Sequence:CCGGCCTAGGTTACTCGGATCCATTCTCGAGAATGGATCCGAGTAACCTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024233    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_015755.1-458s1c1
Sequence:CCGGGAACAGCTACTACCTGGTCATCTCGAGATGACCAGGTAGTAGCTGTTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368791    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-323s21c1
Sequence:CCGGAGCTATCAAGGTCATCGATAACTCGAGTTATCGATGACCTTGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361682    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-971s21c1
Sequence:CCGGCCCTGTGAAGAGGCCGAATATCTCGAGATATTCGGCCTCTTCACAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361683    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-1205s21c1
Sequence:CCGGCAAGAAACTTGAGCGCTATTTCTCGAGAAATAGCGCTCAAGTTTCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361681    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_015755.2-1264s21c1
Sequence:CCGGAGACCCAGCTCTACCAGATAGCTCGAGCTATCTGGTAGAGCTGGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks