EMAIL THIS PAGE TO A FRIEND

IAH1

isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)

UniProtKB ID: Q2TAA2
Gene ID:
Mouse(67732) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Rat(298917) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Zebrafish(449926) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
cow(614320) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
domestic cat(101089259) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
dog(609656) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
chicken(421930) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
sheep(101117317) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
domestic guinea pig(100726448) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
naked mole-rat(101720467) isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001039613 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001039613 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001039613 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026347 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026347 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026347 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU089891 MISSION® esiRNA esiRNA human IAH1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001039613 Rosetta Predictions human pricing
NM_001100540 Rosetta Predictions rat pricing
NM_026347 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039613 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00011296 predicted 446
2 SASI_Hs01_00011297 predicted 280
3 SASI_Hs02_00308600 predicted 486
4 SASI_Hs02_00308601 predicted 392
5 SASI_Hs02_00308602 predicted 214
6 SASI_Hs02_00308603 predicted 489
7 SASI_Hs02_00308604 predicted 286
8 SASI_Hs02_00308605 predicted 221
9 SASI_Hs01_00011301 predicted 484
10 SASI_Hs01_00011305 predicted 386
11 SASI_Hs01_00011298 predicted 468
12 SASI_Hs01_00011299 predicted 338
13 SASI_Hs01_00011300 predicted 252
14 SASI_Hs01_00011302 predicted 469
15 SASI_Hs01_00011303 predicted 543
16 SASI_Hs01_00011304 predicted 344
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001100540 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00209998 predicted 442
2 SASI_Rn02_00209999 predicted 269
3 SASI_Rn02_00210000 predicted 528
4 SASI_Rn02_00210001 predicted 485
5 SASI_Rn02_00210002 predicted 471
6 SASI_Rn02_00210003 predicted 197
7 SASI_Rn02_00210004 predicted 519
8 SASI_Rn02_00210005 predicted 451
9 SASI_Rn02_00210006 predicted 353
10 SASI_Rn02_00210007 predicted 378
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085971 predicted 294
2 SASI_Mm01_00085972 predicted 252
3 SASI_Mm01_00085973 predicted 560
4 SASI_Mm01_00085974 predicted 603
5 SASI_Mm01_00085975 predicted 234
6 SASI_Mm01_00085976 predicted 502
7 SASI_Mm02_00330066 predicted 497
8 SASI_Mm01_00085979 predicted 220
9 SASI_Mm01_00085980 predicted 346
10 SASI_Mm02_00330067 predicted 355
11 SASI_Mm01_00085977 predicted 482
12 SASI_Mm01_00085978 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001039613
VALIDATED
IAH1 MISSION shRNA Bacterial Glycerol Stock
isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000370991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-394s21c1
Sequence:CCGGTCCCTGAGAATCGAGTCATTCCTCGAGGAATGACTCGATTCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-448s21c1
Sequence:CCGGGGGAAGAACAGTGCATCATACCTCGAGGTATGATGCACTGTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-287s21c1
Sequence:CCGGGGCCAATGACAGTGCACTAAACTCGAGTTTAGTGCACTGTCATTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-341s21c1
Sequence:CCGGGGAGTACGCTGCGAACCTAAACTCGAGTTTAGGTTCGCAGCGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-588s21c1
Sequence:CCGGCAGGACTTCTCATCTTATTTACTCGAGTAAATAAGATGAGAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-777s21c1
Sequence:CCGGATCACAGGAGACCCAAATCTGCTCGAGCAGATTTGGGTCTCCTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000253666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-507s21c1
Sequence:CCGGGAATATGCCAATGCGTGTTTACTCGAGTAAACACGCATTGGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-168s21c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001039613
VALIDATED
IAH1 MISSION shRNA shRNA Plasmid DNA
isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000370991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-394s21c1
Sequence:CCGGTCCCTGAGAATCGAGTCATTCCTCGAGGAATGACTCGATTCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-448s21c1
Sequence:CCGGGGGAAGAACAGTGCATCATACCTCGAGGTATGATGCACTGTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-287s21c1
Sequence:CCGGGGCCAATGACAGTGCACTAAACTCGAGTTTAGTGCACTGTCATTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-341s21c1
Sequence:CCGGGGAGTACGCTGCGAACCTAAACTCGAGTTTAGGTTCGCAGCGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-588s21c1
Sequence:CCGGCAGGACTTCTCATCTTATTTACTCGAGTAAATAAGATGAGAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-777s21c1
Sequence:CCGGATCACAGGAGACCCAAATCTGCTCGAGCAGATTTGGGTCTCCTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000253666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-507s21c1
Sequence:CCGGGAATATGCCAATGCGTGTTTACTCGAGTAAACACGCATTGGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-168s21c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001039613
VALIDATED
IAH1 MISSION shRNA Lentiviral Transduction Particles
isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000370991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-394s21c1
Sequence:CCGGTCCCTGAGAATCGAGTCATTCCTCGAGGAATGACTCGATTCTCAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370926    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-448s21c1
Sequence:CCGGGGGAAGAACAGTGCATCATACCTCGAGGTATGATGCACTGTTCTTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370959    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-287s21c1
Sequence:CCGGGGCCAATGACAGTGCACTAAACTCGAGTTTAGTGCACTGTCATTGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-341s21c1
Sequence:CCGGGGAGTACGCTGCGAACCTAAACTCGAGTTTAGGTTCGCAGCGTACTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-588s21c1
Sequence:CCGGCAGGACTTCTCATCTTATTTACTCGAGTAAATAAGATGAGAAGTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253667    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-777s21c1
Sequence:CCGGATCACAGGAGACCCAAATCTGCTCGAGCAGATTTGGGTCTCCTGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000253666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-507s21c1
Sequence:CCGGGAATATGCCAATGCGTGTTTACTCGAGTAAACACGCATTGGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265423    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: A549
TRC Version: 2 Clone ID:NM_001039613.1-168s21c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026347
VALIDATED
IAH1 MISSION shRNA Bacterial Glycerol Stock
isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026347.3-182s21c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-478s21c1
Sequence:CCGGCCTGAAGGGTTGCAAATTAAACTCGAGTTTAATTTGCAACCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026347.3-521s21c1
Sequence:CCGGGAATATGCAAATGCGTGTTTACTCGAGTAAACACGCATTTGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-310s21c1
Sequence:CCGGCTCTTCACTCAAAGATGAGAACTCGAGTTCTCATCTTTGAGTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000278698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-637s21c1
Sequence:CCGGGCATTTATCACCAATGGGAAACTCGAGTTTCCCATTGGTGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-638s1c1
Sequence:CCGGGCATTTATCACCAATGGGAAACTCGAGTTTCCCATTGGTGATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-183s1c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-311s1c1
Sequence:CCGGCTCTTCACTCAAAGATGAGAACTCGAGTTCTCATCTTTGAGTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-479s1c1
Sequence:CCGGCCTGAAGGGTTGCAAATTAAACTCGAGTTTAATTTGCAACCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-522s1c1
Sequence:CCGGGAATATGCAAATGCGTGTTTACTCGAGTAAACACGCATTTGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026347
VALIDATED
IAH1 MISSION shRNA shRNA Plasmid DNA
isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026347.3-182s21c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-478s21c1
Sequence:CCGGCCTGAAGGGTTGCAAATTAAACTCGAGTTTAATTTGCAACCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026347.3-521s21c1
Sequence:CCGGGAATATGCAAATGCGTGTTTACTCGAGTAAACACGCATTTGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-310s21c1
Sequence:CCGGCTCTTCACTCAAAGATGAGAACTCGAGTTCTCATCTTTGAGTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000278698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-637s21c1
Sequence:CCGGGCATTTATCACCAATGGGAAACTCGAGTTTCCCATTGGTGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-638s1c1
Sequence:CCGGGCATTTATCACCAATGGGAAACTCGAGTTTCCCATTGGTGATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-183s1c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-311s1c1
Sequence:CCGGCTCTTCACTCAAAGATGAGAACTCGAGTTCTCATCTTTGAGTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-479s1c1
Sequence:CCGGCCTGAAGGGTTGCAAATTAAACTCGAGTTTAATTTGCAACCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-522s1c1
Sequence:CCGGGAATATGCAAATGCGTGTTTACTCGAGTAAACACGCATTTGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026347
VALIDATED
IAH1 MISSION shRNA Lentiviral Transduction Particles
isoamyl acetate-hydrolyzing esterase 1 homolog (S. cerevisiae)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297583    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026347.3-182s21c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278699    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-478s21c1
Sequence:CCGGCCTGAAGGGTTGCAAATTAAACTCGAGTTTAATTTGCAACCCTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278633    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026347.3-521s21c1
Sequence:CCGGGAATATGCAAATGCGTGTTTACTCGAGTAAACACGCATTTGCATATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278630    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-310s21c1
Sequence:CCGGCTCTTCACTCAAAGATGAGAACTCGAGTTCTCATCTTTGAGTGAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000278698    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026347.3-637s21c1
Sequence:CCGGGCATTTATCACCAATGGGAAACTCGAGTTTCCCATTGGTGATAAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198319    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-638s1c1
Sequence:CCGGGCATTTATCACCAATGGGAAACTCGAGTTTCCCATTGGTGATAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198232    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-183s1c1
Sequence:CCGGGATGTTCTGAATCGTGGATTTCTCGAGAAATCCACGATTCAGAACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-311s1c1
Sequence:CCGGCTCTTCACTCAAAGATGAGAACTCGAGTTCTCATCTTTGAGTGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-479s1c1
Sequence:CCGGCCTGAAGGGTTGCAAATTAAACTCGAGTTTAATTTGCAACCCTTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176812    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026347.2-522s1c1
Sequence:CCGGGAATATGCAAATGCGTGTTTACTCGAGTAAACACGCATTTGCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks