EMAIL THIS PAGE TO A FRIEND

IARS

isoleucyl-tRNA synthetase

Synonyms: IARS1 ILERS ILRS IRS PRO0785
UniProtKB ID: P41252, A8KAE9, Q5TCD0, Q7Z3T4, Q9H588
Gene ID:
Human(3376) Summary: Aminoacyl-tRNA synthetases catalyze the aminoacylation of tRNA by their cognate amino acid. Because of their central role in linking amino acids with nucleotide triplets contained in tRNAS, aminoacyl-tRNA synthetases are thought to be among the first proteins that appeared in evolution. Isoleucine-tRNA synthetase belongs to the class-I aminoacyl-tRNA synthetase family and has been identified as a target of autoantibodies in the autoimmune disease polymyositis/dermatomyositis. Alternatively spliced transcript variants have been found. [provided by RefSeq, Nov 2012]
Mouse(105148) isoleucine-tRNA synthetase
Rat(306804) isoleucyl-tRNA synthetase
Zebrafish(334393) isoleucyl-tRNA synthetase
chicken(415957) isoleucyl-tRNA synthetase
dog(484216) isoleucyl-tRNA synthetase
cow(509885) isoleucyl-tRNA synthetase
Horse(100054721) isoleucyl-tRNA synthetase
sheep(101109674) isoleucyl-tRNA synthetase
Domestic Rabbit(100356680) isoleucyl-tRNA synthetase
domestic guinea pig(100723914) isoleucyl-tRNA synthetase
naked mole-rat(101700176) isoleucyl-tRNA synthetase
110 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002161 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002161 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002161 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172015 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172015 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172015 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002161 Rosetta Predictions human pricing
NM_013417 Rosetta Predictions human pricing
XM_001055989 Rosetta Predictions rat pricing
XM_225196 Rosetta Predictions rat pricing
NM_172015 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002161 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108173 predicted 2329
2 SASI_Hs01_00108174 predicted 825
3 SASI_Hs01_00108175 predicted 2111
4 SASI_Hs01_00108176 predicted 496
5 SASI_Hs01_00108177 predicted 3644
6 SASI_Hs01_00108179 predicted 534
7 SASI_Hs01_00108180 predicted 1161
8 SASI_Hs01_00108181 predicted 3025
9 SASI_Hs01_00108182 predicted 2410
10 SASI_Hs02_00333371 predicted 1020
11 SASI_Hs01_00108178 predicted 1348
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013417 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107630 predicted 2429
2 SASI_Hs01_00107631 predicted 937
3 SASI_Hs01_00107632 predicted 2215
4 SASI_Hs01_00107633 predicted 603
5 SASI_Hs01_00107634 predicted 3746
6 SASI_Hs01_00107636 predicted 646
7 SASI_Hs01_00107637 predicted 1266
8 SASI_Hs01_00107638 predicted 3126
9 SASI_Hs01_00107639 predicted 2513
10 SASI_Hs02_00344804 predicted 1131
11 SASI_Hs01_00107635 predicted 1463
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001055989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00281680 predicted 3130
2 SASI_Rn02_00281681 predicted 3215
3 SASI_Rn02_00281682 predicted 1945
4 SASI_Rn02_00281683 predicted 2808
5 SASI_Rn02_00281684 predicted 2219
6 SASI_Rn02_00281685 predicted 2893
7 SASI_Rn02_00281686 predicted 2826
8 SASI_Rn02_00281687 predicted 3323
9 SASI_Rn02_00281688 predicted 264
10 SASI_Rn02_00281689 predicted 1088
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_225196 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382597 predicted 3132
2 SASI_Rn02_00382598 predicted 3210
3 SASI_Rn02_00382599 predicted 1949
4 SASI_Rn02_00382600 predicted 2808
5 SASI_Rn02_00382601 predicted 2217
6 SASI_Rn02_00382602 predicted 2888
7 SASI_Rn02_00382603 predicted 2825
8 SASI_Rn02_00382604 predicted 3325
9 SASI_Rn02_00382605 predicted 260
10 SASI_Rn02_00382606 predicted 1094
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172015 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00111073 predicted 742
2 SASI_Mm01_00111074 predicted 345
3 SASI_Mm01_00111075 predicted 2972
4 SASI_Mm01_00111076 predicted 3402
5 SASI_Mm01_00111077 predicted 874
6 SASI_Mm01_00111078 predicted 2396
7 SASI_Mm01_00111079 predicted 1893
8 SASI_Mm01_00111080 predicted 2082
9 SASI_Mm02_00343636 predicted 2665
10 SASI_Mm01_00111081 predicted 2555
11 SASI_Mm01_00111082 predicted 3305
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002161
VALIDATED
IARS MISSION shRNA Bacterial Glycerol Stock
isoleucyl-tRNA synthetase
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002161.4-4183s21c1
Sequence:CCGGTACTTCAGCCCACAGTTTATTCTCGAGAATAAACTGTGGGCTGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002161.4-899s21c1
Sequence:CCGGATGTTGCCAGAGGACGATTACCTCGAGGTAATCGTCCTCTGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002161.2-263s1c1
Sequence:CCGGGCGGGTACAATTAAAGATATACTCGAGTATATCTTTAATTGTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002161.2-2297s1c1
Sequence:CCGGCGCAGAAGATTAAAGGGTGAACTCGAGTTCACCCTTTAATCTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-3784s1c1
Sequence:CCGGGCAGGAAATTACAGAAGACATCTCGAGATGTCTTCTGTAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-1826s1c1
Sequence:CCGGCCGCCTTTCAAGAACGTAATTCTCGAGAATTACGTTCTTGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000045855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-2606s1c1
Sequence:CCGGCCCATAAAGTATCCTTTGAAACTCGAGTTTCAAAGGATACTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002161
VALIDATED
IARS MISSION shRNA shRNA Plasmid DNA
isoleucyl-tRNA synthetase
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002161.4-4183s21c1
Sequence:CCGGTACTTCAGCCCACAGTTTATTCTCGAGAATAAACTGTGGGCTGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002161.4-899s21c1
Sequence:CCGGATGTTGCCAGAGGACGATTACCTCGAGGTAATCGTCCTCTGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002161.2-263s1c1
Sequence:CCGGGCGGGTACAATTAAAGATATACTCGAGTATATCTTTAATTGTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002161.2-2297s1c1
Sequence:CCGGCGCAGAAGATTAAAGGGTGAACTCGAGTTCACCCTTTAATCTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-3784s1c1
Sequence:CCGGGCAGGAAATTACAGAAGACATCTCGAGATGTCTTCTGTAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-1826s1c1
Sequence:CCGGCCGCCTTTCAAGAACGTAATTCTCGAGAATTACGTTCTTGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000045855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-2606s1c1
Sequence:CCGGCCCATAAAGTATCCTTTGAAACTCGAGTTTCAAAGGATACTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002161
VALIDATED
IARS MISSION shRNA Lentiviral Transduction Particles
isoleucyl-tRNA synthetase
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421318    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002161.4-4183s21c1
Sequence:CCGGTACTTCAGCCCACAGTTTATTCTCGAGAATAAACTGTGGGCTGAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415729    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002161.4-899s21c1
Sequence:CCGGATGTTGCCAGAGGACGATTACCTCGAGGTAATCGTCCTCTGGCAACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002161.2-263s1c1
Sequence:CCGGGCGGGTACAATTAAAGATATACTCGAGTATATCTTTAATTGTACCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002161.2-2297s1c1
Sequence:CCGGCGCAGAAGATTAAAGGGTGAACTCGAGTTCACCCTTTAATCTTCTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045856    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-3784s1c1
Sequence:CCGGGCAGGAAATTACAGAAGACATCTCGAGATGTCTTCTGTAATTTCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045854    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-1826s1c1
Sequence:CCGGCCGCCTTTCAAGAACGTAATTCTCGAGAATTACGTTCTTGAAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000045855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: A3
TRC Version: 1 Clone ID:NM_002161.2-2606s1c1
Sequence:CCGGCCCATAAAGTATCCTTTGAAACTCGAGTTTCAAAGGATACTTTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172015
VALIDATED
IARS MISSION shRNA Bacterial Glycerol Stock
isoleucyl-tRNA synthetase
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000312129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-3308s21c1
Sequence:CCGGGCTTATGTGAACCTTAACATTCTCGAGAATGTTAAGGTTCACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-938s21c1
Sequence:CCGGCCGTTGTTTGACTACTTTATTCTCGAGAATAAAGTAGTCAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-838s21c1
Sequence:CCGGCTTAACGGAAGCCAGATTATCCTCGAGGATAATCTGGCTTCCGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172015.2-4198s21c1
Sequence:CCGGGAAAGTGGAAGTGGTTTAAATCTCGAGATTTAAACCACTTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172015.3-4010s21c1
Sequence:CCGGACATGGGTTCAGTGAAGTTATCTCGAGATAACTTCACTGAACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000374543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.3-3427s21c1
Sequence:CCGGACTGTTGTTACCAGCGTATTTCTCGAGAAATACGCTGGTAACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-428s1c1
Sequence:CCGGCCGAGCAATCGTGATGAGATACTCGAGTATCTCATCACGATTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-939s1c1
Sequence:CCGGCCGTTGTTTGACTACTTTATTCTCGAGAATAAAGTAGTCAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172015.1-3309s1c1
Sequence:CCGGGCTTATGTGAACCTTAACATTCTCGAGAATGTTAAGGTTCACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-4085s1c1
Sequence:CCGGCCTCACATCATGTTCACATTTCTCGAGAAATGTGAACATGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000076187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-1811s1c1
Sequence:CCGGGCCACCTTTCAAGAATGTGATCTCGAGATCACATTCTTGAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172015
VALIDATED
IARS MISSION shRNA shRNA Plasmid DNA
isoleucyl-tRNA synthetase
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000312129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-3308s21c1
Sequence:CCGGGCTTATGTGAACCTTAACATTCTCGAGAATGTTAAGGTTCACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-938s21c1
Sequence:CCGGCCGTTGTTTGACTACTTTATTCTCGAGAATAAAGTAGTCAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-838s21c1
Sequence:CCGGCTTAACGGAAGCCAGATTATCCTCGAGGATAATCTGGCTTCCGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172015.2-4198s21c1
Sequence:CCGGGAAAGTGGAAGTGGTTTAAATCTCGAGATTTAAACCACTTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172015.3-4010s21c1
Sequence:CCGGACATGGGTTCAGTGAAGTTATCTCGAGATAACTTCACTGAACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000374543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.3-3427s21c1
Sequence:CCGGACTGTTGTTACCAGCGTATTTCTCGAGAAATACGCTGGTAACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-428s1c1
Sequence:CCGGCCGAGCAATCGTGATGAGATACTCGAGTATCTCATCACGATTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-939s1c1
Sequence:CCGGCCGTTGTTTGACTACTTTATTCTCGAGAATAAAGTAGTCAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172015.1-3309s1c1
Sequence:CCGGGCTTATGTGAACCTTAACATTCTCGAGAATGTTAAGGTTCACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-4085s1c1
Sequence:CCGGCCTCACATCATGTTCACATTTCTCGAGAAATGTGAACATGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000076187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-1811s1c1
Sequence:CCGGGCCACCTTTCAAGAATGTGATCTCGAGATCACATTCTTGAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172015
VALIDATED
IARS MISSION shRNA Lentiviral Transduction Particles
isoleucyl-tRNA synthetase
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000312129    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-3308s21c1
Sequence:CCGGGCTTATGTGAACCTTAACATTCTCGAGAATGTTAAGGTTCACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312128    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-938s21c1
Sequence:CCGGCCGTTGTTTGACTACTTTATTCTCGAGAATAAAGTAGTCAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.2-838s21c1
Sequence:CCGGCTTAACGGAAGCCAGATTATCCTCGAGGATAATCTGGCTTCCGTTAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349823    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172015.2-4198s21c1
Sequence:CCGGGAAAGTGGAAGTGGTTTAAATCTCGAGATTTAAACCACTTCCACTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374544    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172015.3-4010s21c1
Sequence:CCGGACATGGGTTCAGTGAAGTTATCTCGAGATAACTTCACTGAACCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000374543    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172015.3-3427s21c1
Sequence:CCGGACTGTTGTTACCAGCGTATTTCTCGAGAAATACGCTGGTAACAACAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076186    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-428s1c1
Sequence:CCGGCCGAGCAATCGTGATGAGATACTCGAGTATCTCATCACGATTGCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076184    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-939s1c1
Sequence:CCGGCCGTTGTTTGACTACTTTATTCTCGAGAATAAAGTAGTCAAACAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076185    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172015.1-3309s1c1
Sequence:CCGGGCTTATGTGAACCTTAACATTCTCGAGAATGTTAAGGTTCACATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076183    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-4085s1c1
Sequence:CCGGCCTCACATCATGTTCACATTTCTCGAGAAATGTGAACATGATGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000076187    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_172015.1-1811s1c1
Sequence:CCGGGCCACCTTTCAAGAATGTGATCTCGAGATCACATTCTTGAAAGGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks