EMAIL THIS PAGE TO A FRIEND

ICAM2

intercellular adhesion molecule 2

Synonyms: CD102
UniProtKB ID: P13598, Q14600
Gene ID:
Human(3384) Summary: The protein encoded by this gene is a member of the intercellular adhesion molecule (ICAM) family. All ICAM proteins are type I transmembrane glycoproteins, contain 2-9 immunoglobulin-like C2-type domains, and bind to the leukocyte adhesion LFA-1 protein. This protein may play a role in lymphocyte recirculation by blocking LFA-1-dependent cell adhesion. It mediates adhesive interactions important for antigen-specific immune response, NK-cell mediated clearance, lymphocyte recirculation, and other cellular interactions important for immune response and surveillance. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(15896) intercellular adhesion molecule 2
Rat(360647) intercellular adhesion molecule 2
domestic guinea pig(100733103) intercellular adhesion molecule 2
naked mole-rat(101713583) intercellular adhesion molecule 2
dog(480475) intercellular adhesion molecule 2
domestic cat(101098907) intercellular adhesion molecule 2
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0677 Human ICAM2 / Intercellular Adhesion Molecule 2 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000873 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010494 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010494 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010494 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000873 Rosetta Predictions human pricing
NM_001099786 Rosetta Predictions human pricing
NM_001099787 Rosetta Predictions human pricing
NM_001099788 Rosetta Predictions human pricing
NM_001099789 Rosetta Predictions human pricing
NM_001007725 Rosetta Predictions rat pricing
NM_010494 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00303402 predicted 403
2 SASI_Hs02_00303403 predicted 414
3 SASI_Hs01_00055764 predicted 473
4 SASI_Hs01_00055767 predicted 889
5 SASI_Hs01_00055770 predicted 686
6 SASI_Hs01_00055771 predicted 696
7 SASI_Hs02_00303404 predicted 856
8 SASI_Hs02_00303405 predicted 752
9 SASI_Hs02_00303406 predicted 895
10 SASI_Hs02_00303407 predicted 574
11 SASI_Hs01_00055762 predicted 597
12 SASI_Hs01_00055763 predicted 686
13 SASI_Hs01_00055765 predicted 230
14 SASI_Hs01_00055766 predicted 772
15 SASI_Hs01_00055768 predicted 238
16 SASI_Hs01_00055769 predicted 262
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099786 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321468 predicted 526
2 SASI_Hs02_00321469 predicted 530
3 SASI_Hs02_00321470 predicted 597
4 SASI_Hs02_00321471 predicted 1010
5 SASI_Hs02_00321472 predicted 805
6 SASI_Hs02_00321473 predicted 823
7 SASI_Hs02_00321474 predicted 976
8 SASI_Hs02_00321475 predicted 875
9 SASI_Hs02_00321476 predicted 1019
10 SASI_Hs02_00321477 predicted 701
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099787 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321478 predicted 448
2 SASI_Hs02_00321479 predicted 455
3 SASI_Hs02_00321480 predicted 523
4 SASI_Hs02_00321481 predicted 930
5 SASI_Hs02_00321482 predicted 724
6 SASI_Hs02_00321483 predicted 738
7 SASI_Hs02_00321484 predicted 901
8 SASI_Hs02_00321485 predicted 793
9 SASI_Hs02_00321486 predicted 936
10 SASI_Hs02_00321487 predicted 619
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099788 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321488 predicted 411
2 SASI_Hs02_00321489 predicted 418
3 SASI_Hs02_00321490 predicted 483
4 SASI_Hs02_00321491 predicted 902
5 SASI_Hs02_00321492 predicted 684
6 SASI_Hs02_00321493 predicted 699
7 SASI_Hs02_00321494 predicted 858
8 SASI_Hs02_00321495 predicted 750
9 SASI_Hs02_00321496 predicted 904
10 SASI_Hs02_00321497 predicted 577
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001099789 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00321498 predicted 331
2 SASI_Hs02_00321499 predicted 332
3 SASI_Hs02_00321500 predicted 398
4 SASI_Hs02_00321501 predicted 817
5 SASI_Hs02_00321502 predicted 602
6 SASI_Hs02_00321503 predicted 617
7 SASI_Hs02_00321504 predicted 781
8 SASI_Hs02_00321505 predicted 672
9 SASI_Hs02_00321506 predicted 814
10 SASI_Hs02_00321507 predicted 501
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00058650 predicted 665
2 SASI_Rn01_00058651 predicted 654
3 SASI_Rn01_00058652 predicted 1088
4 SASI_Rn01_00058653 predicted 1085
5 SASI_Rn01_00058654 predicted 706
6 SASI_Rn01_00058655 predicted 644
7 SASI_Rn01_00058656 predicted 712
8 SASI_Rn01_00058657 predicted 476
9 SASI_Rn01_00058658 predicted 1029
10 SASI_Rn01_00058659 predicted 1012
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032044 predicted 425
2 SASI_Mm01_00032045 predicted 224
3 SASI_Mm01_00032046 predicted 483
4 SASI_Mm01_00032047 predicted 534
5 SASI_Mm01_00032048 predicted 462
6 SASI_Mm01_00032051 predicted 825
7 SASI_Mm02_00318743 predicted 348
8 SASI_Mm01_00032052 predicted 671
9 SASI_Mm01_00032053 predicted 842
10 SASI_Mm02_00318744 predicted 480
11 SASI_Mm01_00032049 predicted 780
12 SASI_Mm01_00032050 predicted 380
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000873
VALIDATED
ICAM2 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000057818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-653s1c1
Sequence:CCGGCGGTGGCAACATCTTTCACAACTCGAGTTGTGAAAGATGTTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000873.2-683s1c1
Sequence:CCGGCCCGAAGATGTTGGAGATCTACTCGAGTAGATCTCCAACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-281s1c1
Sequence:CCGGGAAACATTACTTGGTCTCAAACTCGAGTTTGAGACCAAGTAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-123s1c1
Sequence:CCGGGATGAGAAGGTATTCGAGGTACTCGAGTACCTCGAATACCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-237s1c1
Sequence:CCGGGAGACCTCTCTAAATAAGATTCTCGAGAATCTTATTTAGAGAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-933s21c1
Sequence:CCGGTGCTGTCCCTGTTCGTGACATCTCGAGATGTCACGAACAGGGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-414s21c1
Sequence:CCGGAGACCTCTCTAGATAAGATTCCTCGAGGAATCTTATCTAGAGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-581s21c1
Sequence:CCGGCTGACACTGCAACCCACTTTGCTCGAGCAAAGTGGGTTGCAGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000873
VALIDATED
ICAM2 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000057818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-653s1c1
Sequence:CCGGCGGTGGCAACATCTTTCACAACTCGAGTTGTGAAAGATGTTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000873.2-683s1c1
Sequence:CCGGCCCGAAGATGTTGGAGATCTACTCGAGTAGATCTCCAACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-281s1c1
Sequence:CCGGGAAACATTACTTGGTCTCAAACTCGAGTTTGAGACCAAGTAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-123s1c1
Sequence:CCGGGATGAGAAGGTATTCGAGGTACTCGAGTACCTCGAATACCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-237s1c1
Sequence:CCGGGAGACCTCTCTAAATAAGATTCTCGAGAATCTTATTTAGAGAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-933s21c1
Sequence:CCGGTGCTGTCCCTGTTCGTGACATCTCGAGATGTCACGAACAGGGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-414s21c1
Sequence:CCGGAGACCTCTCTAGATAAGATTCCTCGAGGAATCTTATCTAGAGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-581s21c1
Sequence:CCGGCTGACACTGCAACCCACTTTGCTCGAGCAAAGTGGGTTGCAGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000873
VALIDATED
ICAM2 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000057818    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-653s1c1
Sequence:CCGGCGGTGGCAACATCTTTCACAACTCGAGTTGTGAAAGATGTTGCCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057821    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_000873.2-683s1c1
Sequence:CCGGCCCGAAGATGTTGGAGATCTACTCGAGTAGATCTCCAACATCTTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057822    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-281s1c1
Sequence:CCGGGAAACATTACTTGGTCTCAAACTCGAGTTTGAGACCAAGTAATGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057820    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-123s1c1
Sequence:CCGGGATGAGAAGGTATTCGAGGTACTCGAGTACCTCGAATACCTTCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000873.2-237s1c1
Sequence:CCGGGAGACCTCTCTAAATAAGATTCTCGAGAATCTTATTTAGAGAGGTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442694    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-933s21c1
Sequence:CCGGTGCTGTCCCTGTTCGTGACATCTCGAGATGTCACGAACAGGGACAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-414s21c1
Sequence:CCGGAGACCTCTCTAGATAAGATTCCTCGAGGAATCTTATCTAGAGAGGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437673    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000873.3-581s21c1
Sequence:CCGGCTGACACTGCAACCCACTTTGCTCGAGCAAAGTGGGTTGCAGTGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010494
VALIDATED
ICAM2 MISSION shRNA Bacterial Glycerol Stock
intercellular adhesion molecule 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-1010s1c1
Sequence:CCGGCTGGTGGTTACCAGAACTCAACTCGAGTTGAGTTCTGGTAACCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010494.1-533s1c1
Sequence:CCGGGTGGGTGAAGACTTCACCATTCTCGAGAATGGTGAAGTCTTCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010494.1-878s1c1
Sequence:CCGGGTCCTGCTATGCTTTATCTTTCTCGAGAAAGATAAAGCATAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-184s1c1
Sequence:CCGGGTCTCTTCTTATCCTGTTCTACTCGAGTAGAACAGGATAAGAAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-382s1c1
Sequence:CCGGGAAACAGTTCTTAGTCTCAAACTCGAGTTTGAGACTAAGAACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-329s21c1
Sequence:CCGGCTGGAGACGCCCACGAATAAACTCGAGTTTATTCGTGGGCGTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-382s21c1
Sequence:CCGGGAAACAGTTCTTAGTCTCAAACTCGAGTTTGAGACTAAGAACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-184s21c1
Sequence:CCGGGTCTCTTCTTATCCTGTTCTACTCGAGTAGAACAGGATAAGAAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-833s21c1
Sequence:CCGGATCATCGTGGTGGTGTCAATACTCGAGTATTGACACCACCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000310880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-225s21c1
Sequence:CCGGAGGCCTTTGAGGTCTACATATCTCGAGATATGTAGACCTCAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010494
VALIDATED
ICAM2 MISSION shRNA shRNA Plasmid DNA
intercellular adhesion molecule 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-1010s1c1
Sequence:CCGGCTGGTGGTTACCAGAACTCAACTCGAGTTGAGTTCTGGTAACCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010494.1-533s1c1
Sequence:CCGGGTGGGTGAAGACTTCACCATTCTCGAGAATGGTGAAGTCTTCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010494.1-878s1c1
Sequence:CCGGGTCCTGCTATGCTTTATCTTTCTCGAGAAAGATAAAGCATAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-184s1c1
Sequence:CCGGGTCTCTTCTTATCCTGTTCTACTCGAGTAGAACAGGATAAGAAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-382s1c1
Sequence:CCGGGAAACAGTTCTTAGTCTCAAACTCGAGTTTGAGACTAAGAACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-329s21c1
Sequence:CCGGCTGGAGACGCCCACGAATAAACTCGAGTTTATTCGTGGGCGTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-382s21c1
Sequence:CCGGGAAACAGTTCTTAGTCTCAAACTCGAGTTTGAGACTAAGAACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-184s21c1
Sequence:CCGGGTCTCTTCTTATCCTGTTCTACTCGAGTAGAACAGGATAAGAAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-833s21c1
Sequence:CCGGATCATCGTGGTGGTGTCAATACTCGAGTATTGACACCACCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000310880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-225s21c1
Sequence:CCGGAGGCCTTTGAGGTCTACATATCTCGAGATATGTAGACCTCAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010494
VALIDATED
ICAM2 MISSION shRNA Lentiviral Transduction Particles
intercellular adhesion molecule 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-1010s1c1
Sequence:CCGGCTGGTGGTTACCAGAACTCAACTCGAGTTGAGTTCTGGTAACCACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065974    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010494.1-533s1c1
Sequence:CCGGGTGGGTGAAGACTTCACCATTCTCGAGAATGGTGAAGTCTTCACCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065976    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010494.1-878s1c1
Sequence:CCGGGTCCTGCTATGCTTTATCTTTCTCGAGAAAGATAAAGCATAGCAGGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065977    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-184s1c1
Sequence:CCGGGTCTCTTCTTATCCTGTTCTACTCGAGTAGAACAGGATAAGAAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_010494.1-382s1c1
Sequence:CCGGGAAACAGTTCTTAGTCTCAAACTCGAGTTTGAGACTAAGAACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304288    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-329s21c1
Sequence:CCGGCTGGAGACGCCCACGAATAAACTCGAGTTTATTCGTGGGCGTCTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-382s21c1
Sequence:CCGGGAAACAGTTCTTAGTCTCAAACTCGAGTTTGAGACTAAGAACTGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-184s21c1
Sequence:CCGGGTCTCTTCTTATCCTGTTCTACTCGAGTAGAACAGGATAAGAAGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304287    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-833s21c1
Sequence:CCGGATCATCGTGGTGGTGTCAATACTCGAGTATTGACACCACCACGATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000310880    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010494.1-225s21c1
Sequence:CCGGAGGCCTTTGAGGTCTACATATCTCGAGATATGTAGACCTCAAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks