EMAIL THIS PAGE TO A FRIEND

ICMT

isoprenylcysteine carboxyl methyltransferase

Synonyms: HSTE14 MST098 MSTP098 PCCMT PCMT PPMT
UniProtKB ID: O60725, Q6FHT0
Gene ID:
Human(23463) Summary: This gene encodes the third of three enzymes that posttranslationally modify isoprenylated C-terminal cysteine residues in certain proteins and target those proteins to the cell membrane. This enzyme localizes to the endoplasmic reticulum. Alternative splicing may result in other transcript variants, but the biological validity of those transcripts has not been determined. [provided by RefSeq, Jul 2008]
Mouse(57295) isoprenylcysteine carboxyl methyltransferase
Rat(170818) isoprenylcysteine carboxyl methyltransferase
Zebrafish(550281) isoprenylcysteine carboxyl methyltransferase
dog(489628) isoprenylcysteine carboxyl methyltransferase
cow(785548) isoprenylcysteine carboxyl methyltransferase
domestic cat(101093374) isoprenylcysteine carboxyl methyltransferase
chicken(419373) isoprenylcysteine carboxyl methyltransferase
domestic guinea pig(100725749) isoprenylcysteine carboxyl methyltransferase
naked mole-rat(101708049) isoprenylcysteine carboxyl methyltransferase
sheep(101117687) isoprenylcysteine carboxyl methyltransferase
89 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012405 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012405 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012405 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133788 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133788 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133788 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012405 Rosetta Predictions human pricing
NM_133310 Rosetta Predictions rat pricing
NM_133788 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012405 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00118526 predicted 695
2 SASI_Hs02_00344247 predicted 788
3 SASI_Hs01_00118527 predicted 1417
4 SASI_Hs01_00118528 predicted 370
5 SASI_Hs01_00118529 predicted 342
6 SASI_Hs01_00118530 predicted 363
7 SASI_Hs01_00118531 predicted 605
8 SASI_Hs01_00118532 predicted 491
9 SASI_Hs01_00118533 predicted 824
10 SASI_Hs01_00118534 predicted 335
11 SASI_Hs01_00118535 predicted 1427
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133310 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00267607 predicted 1272
2 SASI_Rn02_00267608 predicted 835
3 SASI_Rn02_00267609 predicted 1038
4 SASI_Rn02_00267610 predicted 1288
5 SASI_Rn02_00267611 predicted 1294
6 SASI_Rn02_00267612 predicted 1330
7 SASI_Rn02_00267613 predicted 1382
8 SASI_Rn02_00267614 predicted 1048
9 SASI_Rn01_00061799 predicted 571
10 SASI_Rn01_00061800 predicted 467
11 SASI_Rn01_00061793 predicted 575
12 SASI_Rn01_00061794 predicted 933
13 SASI_Rn01_00061795 predicted 290
14 SASI_Rn01_00061796 predicted 746
15 SASI_Rn01_00061797 predicted 356
16 SASI_Rn01_00061798 predicted 949
17 SASI_Rn01_00061801 predicted 811
18 SASI_Rn01_00061802 predicted 893
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133788 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00141454 predicted 800
2 SASI_Mm01_00141455 predicted 774
3 SASI_Mm01_00141456 predicted 1219
4 SASI_Mm01_00141457 predicted 289
5 SASI_Mm01_00141458 predicted 207
6 SASI_Mm01_00141459 predicted 1331
7 SASI_Mm02_00338814 predicted 426
8 SASI_Mm01_00141460 predicted 221
9 SASI_Mm01_00141461 predicted 234
10 SASI_Mm01_00141462 predicted 653
11 SASI_Mm01_00141463 predicted 781
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012405
VALIDATED
ICMT MISSION shRNA Bacterial Glycerol Stock
isoprenylcysteine carboxyl methyltransferase
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000310659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-887s21c1
Sequence:CCGGACGGGCCTGCCTTTCATAAAGCTCGAGCTTTATGAAAGGCAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-269s21c1
Sequence:CCGGATAGCCATCCGAGCTTGTTTCCTCGAGGAAACAAGCTCGGATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-476s21c1
Sequence:CCGGGCTGCTCTTTCTTCTTGGTTACTCGAGTAACCAAGAAGAAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-809s21c1
Sequence:CCGGGATCGAACAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-1139s21c1
Sequence:CCGGCATGGGTGAAAGACGAGTAAGCTCGAGCTTACTCGTCTTTCACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-464s1c1
Sequence:CCGGGCTGCTCTTTCTTCTTGGTTACTCGAGTAACCAAGAAGAAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-565s1c1
Sequence:CCGGCTTCGGAGAATGTCTGAGGAACTCGAGTTCCTCAGACATTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-797s1c1
Sequence:CCGGGATCGAACAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012405.2-850s1c1
Sequence:CCGGCCTGGAGTATAAGAAGAGGGTCTCGAGACCCTCTTCTTATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012405.2-367s1c1
Sequence:CCGGGTTCCACTATTCTGAATACTTCTCGAGAAGTATTCAGAATAGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012405
VALIDATED
ICMT MISSION shRNA shRNA Plasmid DNA
isoprenylcysteine carboxyl methyltransferase
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000310659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-887s21c1
Sequence:CCGGACGGGCCTGCCTTTCATAAAGCTCGAGCTTTATGAAAGGCAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-269s21c1
Sequence:CCGGATAGCCATCCGAGCTTGTTTCCTCGAGGAAACAAGCTCGGATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-476s21c1
Sequence:CCGGGCTGCTCTTTCTTCTTGGTTACTCGAGTAACCAAGAAGAAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-809s21c1
Sequence:CCGGGATCGAACAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-1139s21c1
Sequence:CCGGCATGGGTGAAAGACGAGTAAGCTCGAGCTTACTCGTCTTTCACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-464s1c1
Sequence:CCGGGCTGCTCTTTCTTCTTGGTTACTCGAGTAACCAAGAAGAAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-565s1c1
Sequence:CCGGCTTCGGAGAATGTCTGAGGAACTCGAGTTCCTCAGACATTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-797s1c1
Sequence:CCGGGATCGAACAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012405.2-850s1c1
Sequence:CCGGCCTGGAGTATAAGAAGAGGGTCTCGAGACCCTCTTCTTATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012405.2-367s1c1
Sequence:CCGGGTTCCACTATTCTGAATACTTCTCGAGAAGTATTCAGAATAGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012405
VALIDATED
ICMT MISSION shRNA Lentiviral Transduction Particles
isoprenylcysteine carboxyl methyltransferase
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000310659    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-887s21c1
Sequence:CCGGACGGGCCTGCCTTTCATAAAGCTCGAGCTTTATGAAAGGCAGGCCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-269s21c1
Sequence:CCGGATAGCCATCCGAGCTTGTTTCCTCGAGGAAACAAGCTCGGATGGCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-476s21c1
Sequence:CCGGGCTGCTCTTTCTTCTTGGTTACTCGAGTAACCAAGAAGAAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291665    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-809s21c1
Sequence:CCGGGATCGAACAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303341    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_012405.3-1139s21c1
Sequence:CCGGCATGGGTGAAAGACGAGTAAGCTCGAGCTTACTCGTCTTTCACCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035269    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-464s1c1
Sequence:CCGGGCTGCTCTTTCTTCTTGGTTACTCGAGTAACCAAGAAGAAAGAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035270    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-565s1c1
Sequence:CCGGCTTCGGAGAATGTCTGAGGAACTCGAGTTCCTCAGACATTCTCCGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035272    
Product Details
Validated
Region:CDS Mean KnockDown Level: 1.0 Cell Line: A549
TRC Version: 1 Clone ID:NM_012405.2-797s1c1
Sequence:CCGGGATCGAACAGAAGAAGAAGAACTCGAGTTCTTCTTCTTCTGTTCGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035273    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012405.2-850s1c1
Sequence:CCGGCCTGGAGTATAAGAAGAGGGTCTCGAGACCCTCTTCTTATACTCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035271    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012405.2-367s1c1
Sequence:CCGGGTTCCACTATTCTGAATACTTCTCGAGAAGTATTCAGAATAGTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133788
VALIDATED
ICMT MISSION shRNA Bacterial Glycerol Stock
isoprenylcysteine carboxyl methyltransferase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000295337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-331s21c1
Sequence:CCGGTCCACTATTCTGAGTACTTAGCTCGAGCTAAGTACTCAGAATAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133788.1-218s21c1
Sequence:CCGGGATAGCCATCAGAGCTTGTTTCTCGAGAAACAAGCTCTGATGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-459s21c1
Sequence:CCGGGAGAACATCTTCTGGCCAGAACTCGAGTTCTGGCCAGAAGATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000287984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-3630s21c1
Sequence:CCGGCCCAGGAATAAGTATGGTGATCTCGAGATCACCATACTTATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-518s21c1
Sequence:CCGGGATGGTGGTCTTCGGAGAATGCTCGAGCATTCTCCGAAGACCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-3630s1c1
Sequence:CCGGCCCAGGAATAAGTATGGTGATCTCGAGATCACCATACTTATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-218s1c1
Sequence:CCGGGATAGCCATCAGAGCTTGTTTCTCGAGAAACAAGCTCTGATGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133788.1-459s1c1
Sequence:CCGGGAGAACATCTTCTGGCCAGAACTCGAGTTCTGGCCAGAAGATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-654s1c1
Sequence:CCGGCCCTCCTATGTGGGCTGGTTTCTCGAGAAACCAGCCCACATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000097550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-281s1c1
Sequence:CCGGCCAGTCCTCTTGGAATCACTTCTCGAGAAGTGATTCCAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133788
VALIDATED
ICMT MISSION shRNA shRNA Plasmid DNA
isoprenylcysteine carboxyl methyltransferase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000295337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-331s21c1
Sequence:CCGGTCCACTATTCTGAGTACTTAGCTCGAGCTAAGTACTCAGAATAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133788.1-218s21c1
Sequence:CCGGGATAGCCATCAGAGCTTGTTTCTCGAGAAACAAGCTCTGATGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-459s21c1
Sequence:CCGGGAGAACATCTTCTGGCCAGAACTCGAGTTCTGGCCAGAAGATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000287984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-3630s21c1
Sequence:CCGGCCCAGGAATAAGTATGGTGATCTCGAGATCACCATACTTATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-518s21c1
Sequence:CCGGGATGGTGGTCTTCGGAGAATGCTCGAGCATTCTCCGAAGACCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-3630s1c1
Sequence:CCGGCCCAGGAATAAGTATGGTGATCTCGAGATCACCATACTTATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-218s1c1
Sequence:CCGGGATAGCCATCAGAGCTTGTTTCTCGAGAAACAAGCTCTGATGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133788.1-459s1c1
Sequence:CCGGGAGAACATCTTCTGGCCAGAACTCGAGTTCTGGCCAGAAGATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-654s1c1
Sequence:CCGGCCCTCCTATGTGGGCTGGTTTCTCGAGAAACCAGCCCACATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000097550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-281s1c1
Sequence:CCGGCCAGTCCTCTTGGAATCACTTCTCGAGAAGTGATTCCAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133788
VALIDATED
ICMT MISSION shRNA Lentiviral Transduction Particles
isoprenylcysteine carboxyl methyltransferase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000295337    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-331s21c1
Sequence:CCGGTCCACTATTCTGAGTACTTAGCTCGAGCTAAGTACTCAGAATAGTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_133788.1-218s21c1
Sequence:CCGGGATAGCCATCAGAGCTTGTTTCTCGAGAAACAAGCTCTGATGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287908    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-459s21c1
Sequence:CCGGGAGAACATCTTCTGGCCAGAACTCGAGTTCTGGCCAGAAGATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000287984    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-3630s21c1
Sequence:CCGGCCCAGGAATAAGTATGGTGATCTCGAGATCACCATACTTATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295336    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_133788.1-518s21c1
Sequence:CCGGGATGGTGGTCTTCGGAGAATGCTCGAGCATTCTCCGAAGACCACCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097549    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.71 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-3630s1c1
Sequence:CCGGCCCAGGAATAAGTATGGTGATCTCGAGATCACCATACTTATTCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097551    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-218s1c1
Sequence:CCGGGATAGCCATCAGAGCTTGTTTCTCGAGAAACAAGCTCTGATGGCTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097553    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133788.1-459s1c1
Sequence:CCGGGAGAACATCTTCTGGCCAGAACTCGAGTTCTGGCCAGAAGATGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-654s1c1
Sequence:CCGGCCCTCCTATGTGGGCTGGTTTCTCGAGAAACCAGCCCACATAGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000097550    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133788.1-281s1c1
Sequence:CCGGCCAGTCCTCTTGGAATCACTTCTCGAGAAGTGATTCCAAGAGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks