EMAIL THIS PAGE TO A FRIEND

IDI1

isopentenyl-diphosphate delta isomerase 1

Synonyms: IPP1 IPPI1
Gene ID:
Human(3422) Summary: IDI1 encodes a peroxisomally-localized enzyme that catalyzes the interconversion of isopentenyl diphosphate (IPP) to its highly electrophilic isomer, dimethylallyl diphosphate (DMAPP), which are the substrates for the successive reaction that results in the synthesis of farnesyl diphosphate and, ultimately, cholesterol. It has been shown in peroxisomal deficiency diseases such as Zellweger syndrome and neonatal adrenoleukodystrophy that there is reduction in IPP isomerase activity. [provided by RefSeq, Jul 2008]
Mouse(319554) isopentenyl-diphosphate delta isomerase
Rat(89784) isopentenyl-diphosphate delta isomerase 1
Zebrafish(553513) isopentenyl-diphosphate delta isomerase 1
cow(514293) isopentenyl-diphosphate delta isomerase 1
dog(100687634) isopentenyl-diphosphate delta isomerase 1
chicken(420459) isopentenyl-diphosphate delta isomerase 1
domestic guinea pig(100722181) isopentenyl-diphosphate delta isomerase 1
naked mole-rat(101712767) isopentenyl-diphosphate delta isomerase 1
sheep(101108851) isopentenyl-diphosphate delta isomerase 1
85 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004508 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004508 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004508 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_145360 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_145360 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_145360 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004508 Rosetta Predictions human pricing
NM_053539 Rosetta Predictions rat pricing
NM_145360 Rosetta Predictions mouse pricing
NM_177960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004508 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337777 predicted 934
2 SASI_Hs01_00146043 predicted 1040
3 SASI_Hs01_00146045 predicted 956
4 SASI_Hs01_00146046 predicted 713
5 SASI_Hs01_00146047 predicted 927
6 SASI_Hs01_00146048 predicted 803
7 SASI_Hs01_00146049 predicted 906
8 SASI_Hs01_00146051 predicted 856
9 SASI_Hs01_00146052 predicted 688
10 SASI_Hs02_00337778 predicted 794
11 SASI_Hs01_00146044 predicted 762
12 SASI_Hs01_00146050 predicted 684
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053539 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00046884 predicted 515
2 SASI_Rn01_00046885 predicted 731
3 SASI_Rn01_00046886 predicted 813
4 SASI_Rn01_00046887 predicted 523
5 SASI_Rn01_00046888 predicted 421
6 SASI_Rn01_00046889 predicted 434
7 SASI_Rn01_00046890 predicted 949
8 SASI_Rn01_00046891 predicted 727
9 SASI_Rn01_00046892 predicted 745
10 SASI_Rn02_00266160 predicted 890
11 SASI_Rn01_00046893 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00056226 predicted 786
2 SASI_Mm01_00056227 predicted 655
3 SASI_Mm01_00056228 predicted 281
4 SASI_Mm01_00056229 predicted 288
5 SASI_Mm01_00056230 predicted 412
6 SASI_Mm01_00056231 predicted 660
7 SASI_Mm01_00056232 predicted 548
8 SASI_Mm01_00056234 predicted 674
9 SASI_Mm02_00340620 predicted 642
10 SASI_Mm01_00056235 predicted 601
11 SASI_Mm01_00056233 predicted 512
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190484 predicted 802
2 SASI_Mm01_00190485 predicted 663
3 SASI_Mm01_00190486 predicted 292
4 SASI_Mm01_00190487 predicted 304
5 SASI_Mm01_00190488 predicted 421
6 SASI_Mm01_00190489 predicted 676
7 SASI_Mm01_00190490 predicted 560
8 SASI_Mm01_00190492 predicted 686
9 SASI_Mm02_00348445 predicted 647
10 SASI_Mm01_00190493 predicted 613
11 SASI_Mm01_00190491 predicted 524
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004508
VALIDATED
IDI1 MISSION shRNA Bacterial Glycerol Stock
isopentenyl-diphosphate delta isomerase 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000290723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-848s21c1
Sequence:CCGGGCCAGTGGTGAAATTAAGATACTCGAGTATCTTAATTTCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-911s21c1
Sequence:CCGGTGGTGGGATAACTTAAATCATCTCGAGATGATTTAAGTTATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004508.2-540s21c1
Sequence:CCGGCGTGTTGTAGTCATCCATTAACTCGAGTTAATGGATGACTACAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000290725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-776s21c1
Sequence:CCGGCCAGATCCCAATGAGATTAAACTCGAGTTTAATCTCATTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-540s1c1
Sequence:CCGGCGTGTTGTAGTCATCCATTAACTCGAGTTAATGGATGACTACAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-776s1c1
Sequence:CCGGCCAGATCCCAATGAGATTAAACTCGAGTTTAATCTCATTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004508.2-490s1c1
Sequence:CCGGACAGCAAAGATCAGATGCTAACTCGAGTTAGCATCTGATCTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-911s1c1
Sequence:CCGGTGGTGGGATAACTTAAATCATCTCGAGATGATTTAAGTTATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000049174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-848s1c1
Sequence:CCGGGCCAGTGGTGAAATTAAGATACTCGAGTATCTTAATTTCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004508
VALIDATED
IDI1 MISSION shRNA shRNA Plasmid DNA
isopentenyl-diphosphate delta isomerase 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000290723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-848s21c1
Sequence:CCGGGCCAGTGGTGAAATTAAGATACTCGAGTATCTTAATTTCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-911s21c1
Sequence:CCGGTGGTGGGATAACTTAAATCATCTCGAGATGATTTAAGTTATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004508.2-540s21c1
Sequence:CCGGCGTGTTGTAGTCATCCATTAACTCGAGTTAATGGATGACTACAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000290725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-776s21c1
Sequence:CCGGCCAGATCCCAATGAGATTAAACTCGAGTTTAATCTCATTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-540s1c1
Sequence:CCGGCGTGTTGTAGTCATCCATTAACTCGAGTTAATGGATGACTACAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-776s1c1
Sequence:CCGGCCAGATCCCAATGAGATTAAACTCGAGTTTAATCTCATTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004508.2-490s1c1
Sequence:CCGGACAGCAAAGATCAGATGCTAACTCGAGTTAGCATCTGATCTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-911s1c1
Sequence:CCGGTGGTGGGATAACTTAAATCATCTCGAGATGATTTAAGTTATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000049174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-848s1c1
Sequence:CCGGGCCAGTGGTGAAATTAAGATACTCGAGTATCTTAATTTCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004508
VALIDATED
IDI1 MISSION shRNA Lentiviral Transduction Particles
isopentenyl-diphosphate delta isomerase 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000290723    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-848s21c1
Sequence:CCGGGCCAGTGGTGAAATTAAGATACTCGAGTATCTTAATTTCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-911s21c1
Sequence:CCGGTGGTGGGATAACTTAAATCATCTCGAGATGATTTAAGTTATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290654    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004508.2-540s21c1
Sequence:CCGGCGTGTTGTAGTCATCCATTAACTCGAGTTAATGGATGACTACAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000290725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 2 Clone ID:NM_004508.2-776s21c1
Sequence:CCGGCCAGATCCCAATGAGATTAAACTCGAGTTTAATCTCATTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-540s1c1
Sequence:CCGGCGTGTTGTAGTCATCCATTAACTCGAGTTAATGGATGACTACAACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049175    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-776s1c1
Sequence:CCGGCCAGATCCCAATGAGATTAAACTCGAGTTTAATCTCATTGGGATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049176    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.62 Cell Line: A3
TRC Version: 1 Clone ID:NM_004508.2-490s1c1
Sequence:CCGGACAGCAAAGATCAGATGCTAACTCGAGTTAGCATCTGATCTTTGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049177    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-911s1c1
Sequence:CCGGTGGTGGGATAACTTAAATCATCTCGAGATGATTTAAGTTATCCCACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000049174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_004508.2-848s1c1
Sequence:CCGGGCCAGTGGTGAAATTAAGATACTCGAGTATCTTAATTTCACCACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_145360
IDI1 MISSION shRNA Bacterial Glycerol Stock
isopentenyl-diphosphate delta isomerase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000099092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-667s1c1
Sequence:CCGGGTGGGATAACTTAAACCATTTCTCGAGAAATGGTTTAAGTTATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-643s1c1
Sequence:CCGGTGCAGATACTTTCCTCTTCAACTCGAGTTGAAGAGGAAAGTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-398s1c1
Sequence:CCGGCCCTTGGAAGAGGTTGATCTACTCGAGTAGATCAACCTCTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-95s1c1
Sequence:CCGGGCGGAGATGTGTATTCTTATTCTCGAGAATAAGAATACACATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000099090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145360.1-1472s1c1
Sequence:CCGGCCAGCGTAAATGCTCCTGTAACTCGAGTTACAGGAGCATTTACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_145360
IDI1 MISSION shRNA shRNA Plasmid DNA
isopentenyl-diphosphate delta isomerase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000099092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-667s1c1
Sequence:CCGGGTGGGATAACTTAAACCATTTCTCGAGAAATGGTTTAAGTTATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-643s1c1
Sequence:CCGGTGCAGATACTTTCCTCTTCAACTCGAGTTGAAGAGGAAAGTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-398s1c1
Sequence:CCGGCCCTTGGAAGAGGTTGATCTACTCGAGTAGATCAACCTCTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-95s1c1
Sequence:CCGGGCGGAGATGTGTATTCTTATTCTCGAGAATAAGAATACACATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000099090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145360.1-1472s1c1
Sequence:CCGGCCAGCGTAAATGCTCCTGTAACTCGAGTTACAGGAGCATTTACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_145360
IDI1 MISSION shRNA Lentiviral Transduction Particles
isopentenyl-diphosphate delta isomerase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000099092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-667s1c1
Sequence:CCGGGTGGGATAACTTAAACCATTTCTCGAGAAATGGTTTAAGTTATCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099093    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-643s1c1
Sequence:CCGGTGCAGATACTTTCCTCTTCAACTCGAGTTGAAGAGGAAAGTATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-398s1c1
Sequence:CCGGCCCTTGGAAGAGGTTGATCTACTCGAGTAGATCAACCTCTTCCAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_145360.1-95s1c1
Sequence:CCGGGCGGAGATGTGTATTCTTATTCTCGAGAATAAGAATACACATCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000099090    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_145360.1-1472s1c1
Sequence:CCGGCCAGCGTAAATGCTCCTGTAACTCGAGTTACAGGAGCATTTACGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks