EMAIL THIS PAGE TO A FRIEND

IDI2-AS1

IDI2 antisense RNA 1

Synonyms: C10orf110 IDI2-AS
Species: Human IDI2-AS1(55853)
UniProtKB ID: Q9NZ38
Gene ID:
56 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018470 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018470 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018470 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018470 Rosetta Predictions human pricing
XR_039896 Rosetta Predictions human pricing
XR_039897 Rosetta Predictions human pricing
XR_039898 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018470 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00087360 predicted 485
2 SASI_Hs01_00087361 predicted 542
3 SASI_Hs01_00087362 predicted 320
4 SASI_Hs01_00087363 predicted 630
5 SASI_Hs01_00087364 predicted 624
6 SASI_Hs01_00087365 predicted 353
7 SASI_Hs01_00087366 predicted 604
8 SASI_Hs01_00087367 predicted 264
9 SASI_Hs01_00087368 predicted 509
10 SASI_Hs01_00087369 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039896 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514023 predicted 696
2 SASI_Hs02_00514024 predicted 467
3 SASI_Hs02_00514025 predicted 776
4 SASI_Hs02_00514026 predicted 659
5 SASI_Hs02_00514027 predicted 485
6 SASI_Hs02_00514028 predicted 639
7 SASI_Hs02_00514029 predicted 697
8 SASI_Hs02_00514030 predicted 417
9 SASI_Hs02_00514031 predicted 557
10 SASI_Hs02_00514032 predicted 629
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039897 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514033 predicted 697
2 SASI_Hs02_00514034 predicted 465
3 SASI_Hs02_00514035 predicted 776
4 SASI_Hs02_00514036 predicted 657
5 SASI_Hs02_00514037 predicted 476
6 SASI_Hs02_00514038 predicted 645
7 SASI_Hs02_00514039 predicted 690
8 SASI_Hs02_00514040 predicted 416
9 SASI_Hs02_00514041 predicted 553
10 SASI_Hs02_00514042 predicted 624
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039898 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514043 predicted 698
2 SASI_Hs02_00514044 predicted 469
3 SASI_Hs02_00514045 predicted 778
4 SASI_Hs02_00514046 predicted 662
5 SASI_Hs02_00514047 predicted 482
6 SASI_Hs02_00514048 predicted 637
7 SASI_Hs02_00514049 predicted 696
8 SASI_Hs02_00514050 predicted 422
9 SASI_Hs02_00514051 predicted 553
10 SASI_Hs02_00514052 predicted 622
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018470
IDI2-AS1 MISSION shRNA Bacterial Glycerol Stock
IDI2 antisense RNA 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000167604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-592s1c1
Sequence:CCGGGTATTACTGAAGACTGCACTTCTCGAGAAGTGCAGTCTTCAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-662s1c1
Sequence:CCGGGCTTTACAAGAAAGACTGTTTCTCGAGAAACAGTCTTTCTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-453s1c1
Sequence:CCGGCTCTTCTATGAATCCAGAATACTCGAGTATTCTGGATTCATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000172985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-566s1c1
Sequence:CCGGCGAACTGGAACCAACGAGAAACTCGAGTTTCTCGTTGGTTCCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018470
IDI2-AS1 MISSION shRNA shRNA Plasmid DNA
IDI2 antisense RNA 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000167604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-592s1c1
Sequence:CCGGGTATTACTGAAGACTGCACTTCTCGAGAAGTGCAGTCTTCAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-662s1c1
Sequence:CCGGGCTTTACAAGAAAGACTGTTTCTCGAGAAACAGTCTTTCTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-453s1c1
Sequence:CCGGCTCTTCTATGAATCCAGAATACTCGAGTATTCTGGATTCATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000172985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-566s1c1
Sequence:CCGGCGAACTGGAACCAACGAGAAACTCGAGTTTCTCGTTGGTTCCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018470
IDI2-AS1 MISSION shRNA Lentiviral Transduction Particles
IDI2 antisense RNA 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000167604    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-592s1c1
Sequence:CCGGGTATTACTGAAGACTGCACTTCTCGAGAAGTGCAGTCTTCAGTAATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167605    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-662s1c1
Sequence:CCGGGCTTTACAAGAAAGACTGTTTCTCGAGAAACAGTCTTTCTTGTAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167268    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-453s1c1
Sequence:CCGGCTCTTCTATGAATCCAGAATACTCGAGTATTCTGGATTCATAGAAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000172985    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_018470.1-566s1c1
Sequence:CCGGCGAACTGGAACCAACGAGAAACTCGAGTTTCTCGTTGGTTCCAGTTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks