EMAIL THIS PAGE TO A FRIEND

IDO1

indoleamine 2,3-dioxygenase 1

Synonyms: IDO IDO-1 INDO
UniProtKB ID: P14902, Q540B4
Gene ID:
Human(3620) Summary: This gene encodes indoleamine 2,3-dioxygenase (IDO) - a heme enzyme that catalyzes the first and rate-limiting step in tryptophan catabolism to N-formyl-kynurenine. This enzyme acts on multiple tryptophan substrates including D-tryptophan, L-tryptophan, 5-hydroxy-tryptophan, tryptamine, and serotonin. This enzyme is thought to play a role in a variety of pathophysiological processes such as antimicrobial and antitumor defense, neuropathology, immunoregulation, and antioxidant activity. Through its expression in dendritic cells, monocytes, and macrophages this enzyme modulates T-cell behavior by its peri-cellular catabolization of the essential amino acid tryptophan.[provided by RefSeq, Feb 2011]
Mouse(15930) indoleamine 2,3-dioxygenase 1
Rat(66029) indoleamine 2,3-dioxygenase 1
sheep(100196903) indoleamine 2,3-dioxygenase 1
domestic guinea pig(100728309) indoleamine 2,3-dioxygenase 1
naked mole-rat(101723745) indoleamine 2,3-dioxygenase 1
Zebrafish(571967) indoleamine 2,3-dioxygenase 1
dog(475574) indoleamine 2,3-dioxygenase 1
domestic cat(101096977) indoleamine 2,3-dioxygenase 1
cow(506281) indoleamine 2,3-dioxygenase 1
101 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB2501926 Anti-IDO1 antibody produced in goat affinity isolated antibody, buffered aqueous solution mouse, human, rat, canine
ELISA, immunohistochemistry pricing
HPA023072 Anti-IDO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
HPA023149 Anti-IDO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab2 human
immunohistochemistry, western blot pricing
HPA027772 Anti-IDO1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution, Ab3 human
immunohistochemistry, western blot pricing
SAB1100113 Anti-INDO (136-150) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1100112 Anti-INDO (6-20) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1406038 Anti-INDO antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB1411912 ANTI-INDO antibody produced in mouse clone 4C9, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411913 ANTI-INDO antibody produced in mouse clone 4A6, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411914 ANTI-INDO antibody produced in mouse clone 4B1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411915 ANTI-INDO antibody produced in mouse clone 4F9, purified immunoglobulin, buffered aqueous solution human,
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411916 ANTI-INDO antibody produced in mouse clone 1D5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411917 ANTI-INDO antibody produced in mouse clone 1C5, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB1411918 ANTI-INDO antibody produced in mouse clone 1C1, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, immunohistochemistry, western blot pricing
SAB3701446 Monoclonal Anti-IDO1 antibody produced in mouse clone 10.1, purified immunoglobulin mouse, human
ELISA, immunohistochemistry, immunoprecipitation, western blot pricing
WH0003620M5 Monoclonal Anti-INDO antibody produced in mouse clone 4D2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunohistochemistry, western blot pricing
SAB1403979 Monoclonal Anti-INDO antibody produced in mouse clone 3D12-C6, ascites fluid human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_002164 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002164 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002164 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008324 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008324 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008324 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002164 Rosetta Predictions human pricing
NM_023973 Rosetta Predictions rat pricing
NM_008324 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002164 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237226 predicted 638
2 SASI_Hs01_00237227 predicted 1100
3 SASI_Hs02_00333374 predicted 607
4 SASI_Hs01_00237228 predicted 661
5 SASI_Hs02_00333375 predicted 743
6 SASI_Hs01_00237230 predicted 1153
7 SASI_Hs01_00237231 predicted 838
8 SASI_Hs01_00237232 predicted 438
9 SASI_Hs01_00237233 predicted 1146
10 SASI_Hs01_00237235 predicted 1096
11 SASI_Hs01_00237229 predicted 276
12 SASI_Hs01_00237234 predicted 1323
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023973 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00073365 predicted 572
2 SASI_Rn01_00073366 predicted 689
3 SASI_Rn01_00073367 predicted 226
4 SASI_Rn02_00263790 predicted 561
5 SASI_Rn01_00073368 predicted 803
6 SASI_Rn02_00263791 predicted 660
7 SASI_Rn01_00073370 predicted 539
8 SASI_Rn02_00263792 predicted 809
9 SASI_Rn01_00073372 predicted 198
10 SASI_Rn01_00073373 predicted 712
11 SASI_Rn01_00073369 predicted 441
12 SASI_Rn01_00073371 predicted 828
13 SASI_Rn01_00073374 predicted 877
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008324 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00085272 predicted 1055
2 SASI_Mm01_00085273 predicted 1329
3 SASI_Mm01_00085275 predicted 1053
4 SASI_Mm02_00313645 predicted 728
5 SASI_Mm01_00085276 predicted 1275
6 SASI_Mm01_00085277 predicted 1289
7 SASI_Mm01_00085278 predicted 1287
8 SASI_Mm01_00085279 predicted 1304
9 SASI_Mm01_00085280 predicted 389
10 SASI_Mm01_00085281 predicted 941
11 SASI_Mm01_00085274 predicted 1077
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002164
IDO1 MISSION shRNA Bacterial Glycerol Stock
indoleamine 2,3-dioxygenase 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000056744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-1149s1c1
Sequence:CCGGCCATCTGCAAATCGTGACTAACTCGAGTTAGTCACGATTTGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-412s1c1
Sequence:CCGGCGTAAGGTCTTGCCAAGAAATCTCGAGATTTCTTGGCAAGACCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-143s1c1
Sequence:CCGGCAATCAGTAAAGAGTACCATACTCGAGTATGGTACTCTTTACTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-710s1c1
Sequence:CCGGCGCTGTTGGAAATAGCTTCTTCTCGAGAAGAAGCTATTTCCAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002164
IDO1 MISSION shRNA shRNA Plasmid DNA
indoleamine 2,3-dioxygenase 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000056744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-1149s1c1
Sequence:CCGGCCATCTGCAAATCGTGACTAACTCGAGTTAGTCACGATTTGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-412s1c1
Sequence:CCGGCGTAAGGTCTTGCCAAGAAATCTCGAGATTTCTTGGCAAGACCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-143s1c1
Sequence:CCGGCAATCAGTAAAGAGTACCATACTCGAGTATGGTACTCTTTACTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-710s1c1
Sequence:CCGGCGCTGTTGGAAATAGCTTCTTCTCGAGAAGAAGCTATTTCCAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002164
IDO1 MISSION shRNA Lentiviral Transduction Particles
indoleamine 2,3-dioxygenase 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000056744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-1149s1c1
Sequence:CCGGCCATCTGCAAATCGTGACTAACTCGAGTTAGTCACGATTTGCAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-412s1c1
Sequence:CCGGCGTAAGGTCTTGCCAAGAAATCTCGAGATTTCTTGGCAAGACCTTACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-143s1c1
Sequence:CCGGCAATCAGTAAAGAGTACCATACTCGAGTATGGTACTCTTTACTGATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002164.3-710s1c1
Sequence:CCGGCGCTGTTGGAAATAGCTTCTTCTCGAGAAGAAGCTATTTCCAACAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008324
IDO1 MISSION shRNA Bacterial Glycerol Stock
indoleamine 2,3-dioxygenase 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-1120s1c1
Sequence:CCGGCCTCGCAATAGTAGATACTTACTCGAGTAAGTATCTACTATTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-577s1c1
Sequence:CCGGCGTCTCTCTATTGGTGGAAATCTCGAGATTTCCACCAATAGAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-933s1c1
Sequence:CCGGGCAAAGAATCTCCTGCAGAATCTCGAGATTCTGCAGGAGATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-1025s1c1
Sequence:CCGGCCAGTCCGTGAGTTTGTCATTCTCGAGAATGACAAACTCACGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-505s1c1
Sequence:CCGGGCCCATGACATACGAGAACATCTCGAGATGTTCTCGTATGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008324
IDO1 MISSION shRNA shRNA Plasmid DNA
indoleamine 2,3-dioxygenase 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-1120s1c1
Sequence:CCGGCCTCGCAATAGTAGATACTTACTCGAGTAAGTATCTACTATTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-577s1c1
Sequence:CCGGCGTCTCTCTATTGGTGGAAATCTCGAGATTTCCACCAATAGAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-933s1c1
Sequence:CCGGGCAAAGAATCTCCTGCAGAATCTCGAGATTCTGCAGGAGATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-1025s1c1
Sequence:CCGGCCAGTCCGTGAGTTTGTCATTCTCGAGAATGACAAACTCACGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-505s1c1
Sequence:CCGGGCCCATGACATACGAGAACATCTCGAGATGTTCTCGTATGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008324
IDO1 MISSION shRNA Lentiviral Transduction Particles
indoleamine 2,3-dioxygenase 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-1120s1c1
Sequence:CCGGCCTCGCAATAGTAGATACTTACTCGAGTAAGTATCTACTATTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066909    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-577s1c1
Sequence:CCGGCGTCTCTCTATTGGTGGAAATCTCGAGATTTCCACCAATAGAGAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066910    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-933s1c1
Sequence:CCGGGCAAAGAATCTCCTGCAGAATCTCGAGATTCTGCAGGAGATTCTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-1025s1c1
Sequence:CCGGCCAGTCCGTGAGTTTGTCATTCTCGAGAATGACAAACTCACGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008324.1-505s1c1
Sequence:CCGGGCCCATGACATACGAGAACATCTCGAGATGTTCTCGTATGTCATGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks