EMAIL THIS PAGE TO A FRIEND

IFI16

interferon, gamma-inducible protein 16

Synonyms: IFNGIP1 PYHIN2
Species: Human IFI16(3428), domestic guinea pig Ifi16(100718476), naked mole-rat Ifi16(101704976), cow IFI16(506759), domestic cat IFI16(101095311)
Gene ID:
Human(3428) Summary: This gene encodes a member of the HIN-200 (hematopoietic interferon-inducible nuclear antigens with 200 amino acid repeats) family of cytokines. The encoded protein contains domains involved in DNA binding, transcriptional regulation, and protein-protein interactions. The protein localizes to the nucleoplasm and nucleoli, and interacts with p53 and retinoblastoma-1. It modulates p53 function, and inhibits cell growth in the Ras/Raf signaling pathway. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Apr 2011]
domestic guinea pig(100718476) interferon, gamma-inducible protein 16
naked mole-rat(101704976) interferon, gamma-inducible protein 16
cow(506759) interferon, gamma-inducible protein 16
domestic cat(101095311) interferon, gamma-inducible protein 16
28 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005531 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU132681 MISSION® esiRNA esiRNA human IFI16 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005531 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00133539 predicted 1070
2 SASI_Hs01_00133540 predicted 2086
3 SASI_Hs02_00339762 predicted 1791
4 SASI_Hs01_00133544 predicted 2050
5 SASI_Hs01_00133545 predicted 1286
6 SASI_Hs01_00133546 predicted 1664
7 SASI_Hs01_00133547 predicted 2001
8 SASI_Hs01_00133542 predicted 2330
9 SASI_Hs01_00133548 predicted 1086
10 SASI_Hs02_00339763 predicted 895
11 SASI_Hs01_00133541 predicted 2340
12 SASI_Hs01_00133543 predicted 1003
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005531
VALIDATED
IFI16 MISSION shRNA Bacterial Glycerol Stock
interferon, gamma-inducible protein 16
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000019079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1993s1c1
Sequence:CCGGGCAAATTATGTTTGCCGCAATCTCGAGATTGCGGCAAACATAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005531.1-836s1c1
Sequence:CCGGGTCAGGTAACTCCCAGAAGAACTCGAGTTCTTCTGGGAGTTACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1972s1c1
Sequence:CCGGCCAAAGAAGATCATTGCCATACTCGAGTATGGCAATGATCTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-2414s1c1
Sequence:CCGGCTGATTCAAGTATGGAAACTTCTCGAGAAGTTTCCATACTTGAATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000019080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1305s1c1
Sequence:CCGGGACAGGACAATGTCACAATATCTCGAGATATTGTGACATTGTCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005531.2-2506s21c1
Sequence:CCGGTTTATGGAGATAAGGTCTAAGCTCGAGCTTAGACCTTATCTCCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-2006s21c1
Sequence:CCGGGATCATTGCCATAGCAAATTACTCGAGTAATTTGCTATGGCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1289s21c1
Sequence:CCGGCTACGAAATTCAGGATGATAGCTCGAGCTATCATCCTGAATTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1149s21c1
Sequence:CCGGACGTTTGAGGTTCCAAATAAACTCGAGTTTATTTGGAACCTCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1187s21c1
Sequence:CCGGGGAAACTCTGAAGATTGATATCTCGAGATATCAATCTTCAGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-2484s21c1
Sequence:CCGGCTGGATGTCATTGACGATAATCTCGAGATTATCGTCAATGACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005531
VALIDATED
IFI16 MISSION shRNA shRNA Plasmid DNA
interferon, gamma-inducible protein 16
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000019079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1993s1c1
Sequence:CCGGGCAAATTATGTTTGCCGCAATCTCGAGATTGCGGCAAACATAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005531.1-836s1c1
Sequence:CCGGGTCAGGTAACTCCCAGAAGAACTCGAGTTCTTCTGGGAGTTACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1972s1c1
Sequence:CCGGCCAAAGAAGATCATTGCCATACTCGAGTATGGCAATGATCTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-2414s1c1
Sequence:CCGGCTGATTCAAGTATGGAAACTTCTCGAGAAGTTTCCATACTTGAATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000019080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1305s1c1
Sequence:CCGGGACAGGACAATGTCACAATATCTCGAGATATTGTGACATTGTCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005531.2-2506s21c1
Sequence:CCGGTTTATGGAGATAAGGTCTAAGCTCGAGCTTAGACCTTATCTCCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-2006s21c1
Sequence:CCGGGATCATTGCCATAGCAAATTACTCGAGTAATTTGCTATGGCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1289s21c1
Sequence:CCGGCTACGAAATTCAGGATGATAGCTCGAGCTATCATCCTGAATTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1149s21c1
Sequence:CCGGACGTTTGAGGTTCCAAATAAACTCGAGTTTATTTGGAACCTCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1187s21c1
Sequence:CCGGGGAAACTCTGAAGATTGATATCTCGAGATATCAATCTTCAGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-2484s21c1
Sequence:CCGGCTGGATGTCATTGACGATAATCTCGAGATTATCGTCAATGACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005531
VALIDATED
IFI16 MISSION shRNA Lentiviral Transduction Particles
interferon, gamma-inducible protein 16
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000019079    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1993s1c1
Sequence:CCGGGCAAATTATGTTTGCCGCAATCTCGAGATTGCGGCAAACATAATTTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019081    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_005531.1-836s1c1
Sequence:CCGGGTCAGGTAACTCCCAGAAGAACTCGAGTTCTTCTGGGAGTTACCTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019082    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1972s1c1
Sequence:CCGGCCAAAGAAGATCATTGCCATACTCGAGTATGGCAATGATCTTCTTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-2414s1c1
Sequence:CCGGCTGATTCAAGTATGGAAACTTCTCGAGAAGTTTCCATACTTGAATCAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000019080    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005531.1-1305s1c1
Sequence:CCGGGACAGGACAATGTCACAATATCTCGAGATATTGTGACATTGTCCTGTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369339    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_005531.2-2506s21c1
Sequence:CCGGTTTATGGAGATAAGGTCTAAGCTCGAGCTTAGACCTTATCTCCATAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364689    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-2006s21c1
Sequence:CCGGGATCATTGCCATAGCAAATTACTCGAGTAATTTGCTATGGCAATGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369342    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1289s21c1
Sequence:CCGGCTACGAAATTCAGGATGATAGCTCGAGCTATCATCCTGAATTTCGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1149s21c1
Sequence:CCGGACGTTTGAGGTTCCAAATAAACTCGAGTTTATTTGGAACCTCAAACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364688    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-1187s21c1
Sequence:CCGGGGAAACTCTGAAGATTGATATCTCGAGATATCAATCTTCAGAGTTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364735    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_005531.2-2484s21c1
Sequence:CCGGCTGGATGTCATTGACGATAATCTCGAGATTATCGTCAATGACATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks