EMAIL THIS PAGE TO A FRIEND

IFI30

interferon, gamma-inducible protein 30

Synonyms: GILT IFI-30 IP30
UniProtKB ID: P13284, Q76MF9, Q8NEI4, Q8WU77, Q9UL08
Gene ID:
Human(10437) Summary: The protein encoded by this gene is a lysosomal thiol reductase that at low pH can reduce protein disulfide bonds. The enzyme is expressed constitutively in antigen-presenting cells and induced by gamma-interferon in other cell types. This enzyme has an important role in MHC class II-restricted antigen processing. [provided by RefSeq, Jul 2008]
Mouse(65972) interferon gamma inducible protein 30
Rat(290644) interferon gamma inducible protein 30
domestic guinea pig(100715862) interferon, gamma-inducible protein 30
naked mole-rat(101719747) interferon, gamma-inducible protein 30
Zebrafish(336503) interferon gamma inducible protein 30
chicken(420129) interferon, gamma-inducible protein 30
cow(615930) interferon, gamma-inducible protein 30
50 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006332 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006332 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006332 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_023065 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_023065 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_023065 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006332 Rosetta Predictions human pricing
NM_001030026 Rosetta Predictions rat pricing
NM_023065 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006332 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00020461 predicted 692
2 SASI_Hs01_00020462 predicted 544
3 SASI_Hs01_00020463 predicted 535
4 SASI_Hs01_00020464 predicted 410
5 SASI_Hs01_00020465 predicted 323
6 SASI_Hs01_00020467 predicted 322
7 SASI_Hs01_00020468 predicted 678
8 SASI_Hs02_00341364 predicted 462
9 SASI_Hs02_00341365 predicted 469
10 SASI_Hs02_00341366 predicted 731
11 SASI_Hs01_00020466 predicted 487
12 SASI_Hs01_00020469 predicted 746
13 SASI_Hs01_00020470 predicted 430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001030026 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00040965 predicted 330
2 SASI_Rn01_00040966 predicted 545
3 SASI_Rn01_00040968 predicted 350
4 SASI_Rn01_00040969 predicted 646
5 SASI_Rn01_00040970 predicted 994
6 SASI_Rn01_00040972 predicted 286
7 SASI_Rn01_00040973 predicted 317
8 SASI_Rn01_00040974 predicted 866
9 SASI_Rn02_00203532 predicted 369
10 SASI_Rn02_00203533 predicted 1012
11 SASI_Rn01_00040967 predicted 311
12 SASI_Rn01_00040971 predicted 824
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023065 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00137819 predicted 230
2 SASI_Mm02_00326789 predicted 198
3 SASI_Mm01_00137820 predicted 245
4 SASI_Mm01_00137821 predicted 750
5 SASI_Mm01_00137822 predicted 208
6 SASI_Mm01_00137823 predicted 335
7 SASI_Mm01_00137825 predicted 693
8 SASI_Mm01_00137826 predicted 455
9 SASI_Mm01_00137827 predicted 439
10 SASI_Mm01_00137828 predicted 545
11 SASI_Mm01_00137824 predicted 564
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006332
VALIDATED
IFI30 MISSION shRNA Bacterial Glycerol Stock
interferon, gamma-inducible protein 30
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000377628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-430s21c1
Sequence:CCGGTGGAGAAGAGGAGTGCAAATTCTCGAGAATTTGCACTCCTCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-701s21c1
Sequence:CCGGGTCAATGGGAAACCCTTGGAACTCGAGTTCCAAGGGTTTCCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000312497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-587s21c1
Sequence:CCGGCCAGACACTATCATGGAGTGTCTCGAGACACTCCATGATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-164s21c1
Sequence:CCGGGCGTTAGACTTCTTTGGGAATCTCGAGATTCCCAAAGAAGTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000370954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-199s21c1
Sequence:CCGGCTACAAGACAGGCAATCTATACTCGAGTATAGATTGCCTGTCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-164s1c1
Sequence:CCGGGCGTTAGACTTCTTTGGGAATCTCGAGATTCCCAAAGAAGTCTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-587s1c1
Sequence:CCGGCCAGACACTATCATGGAGTGTCTCGAGACACTCCATGATAGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-371s1c1
Sequence:CCGGCCCTACGGAAACGCACAGGAACTCGAGTTCCTGTGCGTTTCCGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-253s1c1
Sequence:CCGGGCTTGTCAATGTGACCCTCTACTCGAGTAGAGGGTCACATTGACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000029303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-701s1c1
Sequence:CCGGGTCAATGGGAAACCCTTGGAACTCGAGTTCCAAGGGTTTCCCATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006332
VALIDATED
IFI30 MISSION shRNA shRNA Plasmid DNA
interferon, gamma-inducible protein 30
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000377628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-430s21c1
Sequence:CCGGTGGAGAAGAGGAGTGCAAATTCTCGAGAATTTGCACTCCTCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-701s21c1
Sequence:CCGGGTCAATGGGAAACCCTTGGAACTCGAGTTCCAAGGGTTTCCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000312497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-587s21c1
Sequence:CCGGCCAGACACTATCATGGAGTGTCTCGAGACACTCCATGATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-164s21c1
Sequence:CCGGGCGTTAGACTTCTTTGGGAATCTCGAGATTCCCAAAGAAGTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000370954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-199s21c1
Sequence:CCGGCTACAAGACAGGCAATCTATACTCGAGTATAGATTGCCTGTCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-164s1c1
Sequence:CCGGGCGTTAGACTTCTTTGGGAATCTCGAGATTCCCAAAGAAGTCTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-587s1c1
Sequence:CCGGCCAGACACTATCATGGAGTGTCTCGAGACACTCCATGATAGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-371s1c1
Sequence:CCGGCCCTACGGAAACGCACAGGAACTCGAGTTCCTGTGCGTTTCCGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-253s1c1
Sequence:CCGGGCTTGTCAATGTGACCCTCTACTCGAGTAGAGGGTCACATTGACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000029303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-701s1c1
Sequence:CCGGGTCAATGGGAAACCCTTGGAACTCGAGTTCCAAGGGTTTCCCATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006332
VALIDATED
IFI30 MISSION shRNA Lentiviral Transduction Particles
interferon, gamma-inducible protein 30
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000377628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-430s21c1
Sequence:CCGGTGGAGAAGAGGAGTGCAAATTCTCGAGAATTTGCACTCCTCTTCTCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312435    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-701s21c1
Sequence:CCGGGTCAATGGGAAACCCTTGGAACTCGAGTTCCAAGGGTTTCCCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000312497    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-587s21c1
Sequence:CCGGCCAGACACTATCATGGAGTGTCTCGAGACACTCCATGATAGTGTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-164s21c1
Sequence:CCGGGCGTTAGACTTCTTTGGGAATCTCGAGATTCCCAAAGAAGTCTAACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000370954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006332.3-199s21c1
Sequence:CCGGCTACAAGACAGGCAATCTATACTCGAGTATAGATTGCCTGTCTTGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029299    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-164s1c1
Sequence:CCGGGCGTTAGACTTCTTTGGGAATCTCGAGATTCCCAAAGAAGTCTAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029301    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-587s1c1
Sequence:CCGGCCAGACACTATCATGGAGTGTCTCGAGACACTCCATGATAGTGTCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-371s1c1
Sequence:CCGGCCCTACGGAAACGCACAGGAACTCGAGTTCCTGTGCGTTTCCGTAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029300    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-253s1c1
Sequence:CCGGGCTTGTCAATGTGACCCTCTACTCGAGTAGAGGGTCACATTGACAAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000029303    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006332.3-701s1c1
Sequence:CCGGGTCAATGGGAAACCCTTGGAACTCGAGTTCCAAGGGTTTCCCATTGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_023065
VALIDATED
IFI30 MISSION shRNA Bacterial Glycerol Stock
interferon, gamma-inducible protein 30
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000314117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023065.3-206s21c1
Sequence:CCGGTGTCAGAGTCAGCCTGTATTACTCGAGTAATACAGGCTGACTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023065.3-815s21c1
Sequence:CCGGCCAGCTTCTTCAAATTGCCAACTCGAGTTGGCAATTTGAAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-386s21c1
Sequence:CCGGGCTGGAGTGTAGACTGAACATCTCGAGATGTTCAGTCTACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-775s21c1
Sequence:CCGGAGTAAAGGCATAACCTCAAACCTCGAGGTTTGAGGTTATGCCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023065.3-577s21c1
Sequence:CCGGCACAGCTCATGCATGAGAATGCTCGAGCATTCTCATGCATGAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-650s21c1
Sequence:CCGGGGTCAATGAGAAACCTTTGAACTCGAGTTCAAAGGTTTCTCATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-801s1c1
Sequence:CCGGCCAGCTTCTTCAAATTGCCAACTCGAGTTGGCAATTTGAAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023065.2-448s1c1
Sequence:CCGGGTCTGTATGGAGGAGATGGATCTCGAGATCCATCTCCTCCATACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-434s1c1
Sequence:CCGGCGTTCCTAACCATCGTCTGTACTCGAGTACAGACGATGGTTAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023065.2-203s1c1
Sequence:CCGGGCCTGTATTATGAGTCCCTGTCTCGAGACAGGGACTCATAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-372s1c1
Sequence:CCGGGCTGGAGTGTAGACTGAACATCTCGAGATGTTCAGTCTACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_023065
VALIDATED
IFI30 MISSION shRNA shRNA Plasmid DNA
interferon, gamma-inducible protein 30
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000314117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023065.3-206s21c1
Sequence:CCGGTGTCAGAGTCAGCCTGTATTACTCGAGTAATACAGGCTGACTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023065.3-815s21c1
Sequence:CCGGCCAGCTTCTTCAAATTGCCAACTCGAGTTGGCAATTTGAAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-386s21c1
Sequence:CCGGGCTGGAGTGTAGACTGAACATCTCGAGATGTTCAGTCTACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-775s21c1
Sequence:CCGGAGTAAAGGCATAACCTCAAACCTCGAGGTTTGAGGTTATGCCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023065.3-577s21c1
Sequence:CCGGCACAGCTCATGCATGAGAATGCTCGAGCATTCTCATGCATGAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-650s21c1
Sequence:CCGGGGTCAATGAGAAACCTTTGAACTCGAGTTCAAAGGTTTCTCATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-801s1c1
Sequence:CCGGCCAGCTTCTTCAAATTGCCAACTCGAGTTGGCAATTTGAAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023065.2-448s1c1
Sequence:CCGGGTCTGTATGGAGGAGATGGATCTCGAGATCCATCTCCTCCATACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-434s1c1
Sequence:CCGGCGTTCCTAACCATCGTCTGTACTCGAGTACAGACGATGGTTAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023065.2-203s1c1
Sequence:CCGGGCCTGTATTATGAGTCCCTGTCTCGAGACAGGGACTCATAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-372s1c1
Sequence:CCGGGCTGGAGTGTAGACTGAACATCTCGAGATGTTCAGTCTACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_023065
VALIDATED
IFI30 MISSION shRNA Lentiviral Transduction Particles
interferon, gamma-inducible protein 30
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000314117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023065.3-206s21c1
Sequence:CCGGTGTCAGAGTCAGCCTGTATTACTCGAGTAATACAGGCTGACTCTGACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317915    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_023065.3-815s21c1
Sequence:CCGGCCAGCTTCTTCAAATTGCCAACTCGAGTTGGCAATTTGAAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349531    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-386s21c1
Sequence:CCGGGCTGGAGTGTAGACTGAACATCTCGAGATGTTCAGTCTACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350049    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-775s21c1
Sequence:CCGGAGTAAAGGCATAACCTCAAACCTCGAGGTTTGAGGTTATGCCTTTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375981    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_023065.3-577s21c1
Sequence:CCGGCACAGCTCATGCATGAGAATGCTCGAGCATTCTCATGCATGAGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_023065.3-650s21c1
Sequence:CCGGGGTCAATGAGAAACCTTTGAACTCGAGTTCAAAGGTTTCTCATTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-801s1c1
Sequence:CCGGCCAGCTTCTTCAAATTGCCAACTCGAGTTGGCAATTTGAAGAAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101253    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023065.2-448s1c1
Sequence:CCGGGTCTGTATGGAGGAGATGGATCTCGAGATCCATCTCCTCCATACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101254    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-434s1c1
Sequence:CCGGCGTTCCTAACCATCGTCTGTACTCGAGTACAGACGATGGTTAGGAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101252    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_023065.2-203s1c1
Sequence:CCGGGCCTGTATTATGAGTCCCTGTCTCGAGACAGGGACTCATAATACAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101251    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_023065.2-372s1c1
Sequence:CCGGGCTGGAGTGTAGACTGAACATCTCGAGATGTTCAGTCTACACTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks