EMAIL THIS PAGE TO A FRIEND

IFI35

interferon-induced protein 35

Synonyms: IFP35
UniProtKB ID: P80217, C9JGX1, Q92984, Q99537, Q9BV98
Gene ID:
Mouse(70110) interferon-induced protein 35
Rat(287719) interferon-induced protein 35
Zebrafish(559610) interferon-induced protein 35
chicken(420011) interferon-induced protein 35
dog(490954) interferon-induced protein 35
cow(510697) interferon-induced protein 35
domestic cat(101093657) interferon-induced protein 35
sheep(101108064) interferon-induced protein 35
domestic guinea pig(100721788) interferon-induced protein 35
naked mole-rat(101705834) interferon-induced protein 35
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_005533 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005533 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005533 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_027320 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027320 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027320 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005533 Rosetta Predictions human pricing
NM_001009625 Rosetta Predictions rat pricing
NM_027320 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005533 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00339767 predicted 750
2 SASI_Hs01_00176230 predicted 318
3 SASI_Hs01_00176231 predicted 767
4 SASI_Hs01_00176232 predicted 764
5 SASI_Hs01_00176233 predicted 283
6 SASI_Hs01_00176234 predicted 309
7 SASI_Hs01_00176235 predicted 310
8 SASI_Hs01_00176237 predicted 376
9 SASI_Hs01_00176239 predicted 248
10 SASI_Hs02_00339768 predicted 833
11 SASI_Hs01_00176236 predicted 763
12 SASI_Hs01_00176238 predicted 326
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009625 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059745 predicted 210
2 SASI_Rn01_00059746 predicted 542
3 SASI_Rn01_00059747 predicted 579
4 SASI_Rn01_00059748 predicted 256
5 SASI_Rn02_00199631 predicted 234
6 SASI_Rn01_00059750 predicted 831
7 SASI_Rn01_00059751 predicted 518
8 SASI_Rn01_00059752 predicted 328
9 SASI_Rn01_00059753 predicted 332
10 SASI_Rn01_00059754 predicted 587
11 SASI_Rn01_00059749 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027320 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00331942 predicted 557
2 SASI_Mm02_00331943 predicted 877
3 SASI_Mm01_00167017 predicted 821
4 SASI_Mm02_00331944 predicted 239
5 SASI_Mm02_00331945 predicted 530
6 SASI_Mm01_00167021 predicted 648
7 SASI_Mm01_00167022 predicted 457
8 SASI_Mm01_00167023 predicted 719
9 SASI_Mm01_00167024 predicted 611
10 SASI_Mm01_00167025 predicted 573
11 SASI_Mm01_00167016 predicted 300
12 SASI_Mm01_00167018 predicted 413
13 SASI_Mm01_00167019 predicted 325
14 SASI_Mm01_00167020 predicted 315
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005533
VALIDATED
IFI35 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein 35
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000156165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-617s1c1
Sequence:CCGGCTTCTTTGGCAAGACTAGGAACTCGAGTTCCTAGTCTTGCCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-334s1c1
Sequence:CCGGCTTTAGTTTCCAATTTGCGGACTCGAGTCCGCAAATTGGAAACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-321s1c1
Sequence:CCGGGAAGTGCCTAAGTCTTTAGTTCTCGAGAACTAAAGACTTAGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-851s1c1
Sequence:CCGGGCTCAACATTCCTGATATCTTCTCGAGAAGATATCAGGAATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-326s1c1
Sequence:CCGGGCCTAAGTCTTTAGTTTCCAACTCGAGTTGGAAACTAAAGACTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-846s1c1
Sequence:CCGGCTGGTGCTCAACATTCCTGATCTCGAGATCAGGAATGTTGAGCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-843s1c1
Sequence:CCGGGTACTGGTGCTCAACATTCCTCTCGAGAGGAATGTTGAGCACCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-599s1c1
Sequence:CCGGGCTGGACAAGCTAGAGATCTTCTCGAGAAGATCTCTAGCTTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-318s1c1
Sequence:CCGGCCGGAAGTGCCTAAGTCTTTACTCGAGTAAAGACTTAGGCACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-899s21c1
Sequence:CCGGGTACTGGTGCTCAACATTCCTCTCGAGAGGAATGTTGAGCACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000352753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-907s21c1
Sequence:CCGGGCTCAACATTCCTGATATCTTCTCGAGAAGATATCAGGAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-655s21c1
Sequence:CCGGGCTGGACAAGCTAGAGATCTTCTCGAGAAGATCTCTAGCTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-673s21c1
Sequence:CCGGCTTCTTTGGCAAGACTAGGAACTCGAGTTCCTAGTCTTGCCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000343212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-377s21c1
Sequence:CCGGGAAGTGCCTAAGTCTTTAGTTCTCGAGAACTAAAGACTTAGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005533
VALIDATED
IFI35 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein 35
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000156165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-617s1c1
Sequence:CCGGCTTCTTTGGCAAGACTAGGAACTCGAGTTCCTAGTCTTGCCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-334s1c1
Sequence:CCGGCTTTAGTTTCCAATTTGCGGACTCGAGTCCGCAAATTGGAAACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-321s1c1
Sequence:CCGGGAAGTGCCTAAGTCTTTAGTTCTCGAGAACTAAAGACTTAGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-851s1c1
Sequence:CCGGGCTCAACATTCCTGATATCTTCTCGAGAAGATATCAGGAATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-326s1c1
Sequence:CCGGGCCTAAGTCTTTAGTTTCCAACTCGAGTTGGAAACTAAAGACTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-846s1c1
Sequence:CCGGCTGGTGCTCAACATTCCTGATCTCGAGATCAGGAATGTTGAGCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-843s1c1
Sequence:CCGGGTACTGGTGCTCAACATTCCTCTCGAGAGGAATGTTGAGCACCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-599s1c1
Sequence:CCGGGCTGGACAAGCTAGAGATCTTCTCGAGAAGATCTCTAGCTTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-318s1c1
Sequence:CCGGCCGGAAGTGCCTAAGTCTTTACTCGAGTAAAGACTTAGGCACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-899s21c1
Sequence:CCGGGTACTGGTGCTCAACATTCCTCTCGAGAGGAATGTTGAGCACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000352753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-907s21c1
Sequence:CCGGGCTCAACATTCCTGATATCTTCTCGAGAAGATATCAGGAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-655s21c1
Sequence:CCGGGCTGGACAAGCTAGAGATCTTCTCGAGAAGATCTCTAGCTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-673s21c1
Sequence:CCGGCTTCTTTGGCAAGACTAGGAACTCGAGTTCCTAGTCTTGCCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000343212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-377s21c1
Sequence:CCGGGAAGTGCCTAAGTCTTTAGTTCTCGAGAACTAAAGACTTAGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005533
VALIDATED
IFI35 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein 35
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000156165    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-617s1c1
Sequence:CCGGCTTCTTTGGCAAGACTAGGAACTCGAGTTCCTAGTCTTGCCAAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151864    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-334s1c1
Sequence:CCGGCTTTAGTTTCCAATTTGCGGACTCGAGTCCGCAAATTGGAAACTAAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151540    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-321s1c1
Sequence:CCGGGAAGTGCCTAAGTCTTTAGTTCTCGAGAACTAAAGACTTAGGCACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151203    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-851s1c1
Sequence:CCGGGCTCAACATTCCTGATATCTTCTCGAGAAGATATCAGGAATGTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150513    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-326s1c1
Sequence:CCGGGCCTAAGTCTTTAGTTTCCAACTCGAGTTGGAAACTAAAGACTTAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158397    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-846s1c1
Sequence:CCGGCTGGTGCTCAACATTCCTGATCTCGAGATCAGGAATGTTGAGCACCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156851    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-843s1c1
Sequence:CCGGGTACTGGTGCTCAACATTCCTCTCGAGAGGAATGTTGAGCACCAGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156737    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_005533.2-599s1c1
Sequence:CCGGGCTGGACAAGCTAGAGATCTTCTCGAGAAGATCTCTAGCTTGTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158112    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_005533.2-318s1c1
Sequence:CCGGCCGGAAGTGCCTAAGTCTTTACTCGAGTAAAGACTTAGGCACTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-899s21c1
Sequence:CCGGGTACTGGTGCTCAACATTCCTCTCGAGAGGAATGTTGAGCACCAGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000352753    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-907s21c1
Sequence:CCGGGCTCAACATTCCTGATATCTTCTCGAGAAGATATCAGGAATGTTGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-655s21c1
Sequence:CCGGGCTGGACAAGCTAGAGATCTTCTCGAGAAGATCTCTAGCTTGTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343268    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-673s21c1
Sequence:CCGGCTTCTTTGGCAAGACTAGGAACTCGAGTTCCTAGTCTTGCCAAAGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000343212    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005533.3-377s21c1
Sequence:CCGGGAAGTGCCTAAGTCTTTAGTTCTCGAGAACTAAAGACTTAGGCACTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027320
VALIDATED
IFI35 MISSION shRNA Bacterial Glycerol Stock
interferon-induced protein 35
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-786s1c1
Sequence:CCGGGCCGAGATCAAATTCCAGCAACTCGAGTTGCTGGAATTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-687s1c1
Sequence:CCGGGCCCAGCACTTATGCCAGATTCTCGAGAATCTGGCATAAGTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-267s1c1
Sequence:CCGGCCTCTGGTATTCCAAGGCCAACTCGAGTTGGCCTTGGAATACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-310s1c1
Sequence:CCGGCCAAGTTTGTAGTTTCTAACTCTCGAGAGTTAGAAACTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-758s1c1
Sequence:CCGGTCCCTATGTGAGTGGTGAGATCTCGAGATCTCACCACTCACATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-1097s21c1
Sequence:CCGGTGCTACCAAGAACGGTCAAAGCTCGAGCTTTGACCGTTCTTGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-583s21c1
Sequence:CCGGTAACCACAGGGTGCTCGTTAGCTCGAGCTAACGAGCACCCTGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-483s21c1
Sequence:CCGGAGGAACACAGAGTTAACTTAGCTCGAGCTAAGTTAACTCTGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-881s21c1
Sequence:CCGGCATTCAGTGCTGGTGACAAATCTCGAGATTTGTCACCAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027320.4-663s21c1
Sequence:CCGGTCTTTGGCAAGGCCAAGAATGCTCGAGCATTCTTGGCCTTGCCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027320
VALIDATED
IFI35 MISSION shRNA shRNA Plasmid DNA
interferon-induced protein 35
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-786s1c1
Sequence:CCGGGCCGAGATCAAATTCCAGCAACTCGAGTTGCTGGAATTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-687s1c1
Sequence:CCGGGCCCAGCACTTATGCCAGATTCTCGAGAATCTGGCATAAGTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-267s1c1
Sequence:CCGGCCTCTGGTATTCCAAGGCCAACTCGAGTTGGCCTTGGAATACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-310s1c1
Sequence:CCGGCCAAGTTTGTAGTTTCTAACTCTCGAGAGTTAGAAACTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-758s1c1
Sequence:CCGGTCCCTATGTGAGTGGTGAGATCTCGAGATCTCACCACTCACATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-1097s21c1
Sequence:CCGGTGCTACCAAGAACGGTCAAAGCTCGAGCTTTGACCGTTCTTGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-583s21c1
Sequence:CCGGTAACCACAGGGTGCTCGTTAGCTCGAGCTAACGAGCACCCTGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-483s21c1
Sequence:CCGGAGGAACACAGAGTTAACTTAGCTCGAGCTAAGTTAACTCTGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-881s21c1
Sequence:CCGGCATTCAGTGCTGGTGACAAATCTCGAGATTTGTCACCAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027320.4-663s21c1
Sequence:CCGGTCTTTGGCAAGGCCAAGAATGCTCGAGCATTCTTGGCCTTGCCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027320
VALIDATED
IFI35 MISSION shRNA Lentiviral Transduction Particles
interferon-induced protein 35
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100985    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-786s1c1
Sequence:CCGGGCCGAGATCAAATTCCAGCAACTCGAGTTGCTGGAATTTGATCTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100986    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-687s1c1
Sequence:CCGGGCCCAGCACTTATGCCAGATTCTCGAGAATCTGGCATAAGTGCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100987    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.74 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-267s1c1
Sequence:CCGGCCTCTGGTATTCCAAGGCCAACTCGAGTTGGCCTTGGAATACCAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-310s1c1
Sequence:CCGGCCAAGTTTGTAGTTTCTAACTCTCGAGAGTTAGAAACTACAAACTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_027320.1-758s1c1
Sequence:CCGGTCCCTATGTGAGTGGTGAGATCTCGAGATCTCACCACTCACATAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238158    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-1097s21c1
Sequence:CCGGTGCTACCAAGAACGGTCAAAGCTCGAGCTTTGACCGTTCTTGGTAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238160    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-583s21c1
Sequence:CCGGTAACCACAGGGTGCTCGTTAGCTCGAGCTAACGAGCACCCTGTGGTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238161    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-483s21c1
Sequence:CCGGAGGAACACAGAGTTAACTTAGCTCGAGCTAAGTTAACTCTGTGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_027320.4-881s21c1
Sequence:CCGGCATTCAGTGCTGGTGACAAATCTCGAGATTTGTCACCAGCACTGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_027320.4-663s21c1
Sequence:CCGGTCTTTGGCAAGGCCAAGAATGCTCGAGCATTCTTGGCCTTGCCAAAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks