EMAIL THIS PAGE TO A FRIEND

IFNE

interferon, epsilon

Synonyms: IFN-E IFNE1 IFNT1 INFE1 PRO655
UniProtKB ID: Q86WN2
Gene ID:
Mouse(230405) interferon epsilon
Rat(298225) interferon, epsilon
cow(101904725) interferon, epsilon
domestic cat(101086758) interferon, epsilon
dog(100686472) interferon, epsilon
sheep(101104211) interferon, epsilon
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_176891 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176891 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176891 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177348 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177348 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177348 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_176891 Rosetta Predictions human pricing
XM_233165 Rosetta Predictions rat pricing
XR_007405 Rosetta Predictions rat pricing
NM_177348 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176891 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00244614 predicted 667
2 SASI_Hs01_00244615 predicted 1023
3 SASI_Hs01_00244616 predicted 929
4 SASI_Hs01_00244617 predicted 1208
5 SASI_Hs01_00244618 predicted 1005
6 SASI_Hs01_00244619 predicted 1030
7 SASI_Hs01_00244620 predicted 1193
8 SASI_Hs01_00244621 predicted 1012
9 SASI_Hs02_00369289 predicted 891
10 SASI_Hs02_00369290 predicted 735
11 SASI_Hs01_00244622 predicted 969
12 SASI_Hs01_00244623 predicted 699
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_233165 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00166315 predicted 327
2 SASI_Rn01_00166316 predicted 350
3 SASI_Rn01_00166317 predicted 353
4 SASI_Rn01_00166318 predicted 335
5 SASI_Rn01_00166319 predicted 204
6 SASI_Rn01_00166320 predicted 243
7 SASI_Rn01_00166321 predicted 243
8 SASI_Rn01_00166322 predicted 349
9 SASI_Rn01_00166323 predicted 223
10 SASI_Rn01_00166324 predicted 234
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_007405 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00187400 predicted 478
2 SASI_Rn01_00187401 predicted 415
3 SASI_Rn01_00187402 predicted 1022
4 SASI_Rn01_00187403 predicted 713
5 SASI_Rn01_00187404 predicted 742
6 SASI_Rn01_00187407 predicted 396
7 SASI_Rn01_00187409 predicted 696
8 SASI_Rn02_00414492 predicted 571
9 SASI_Rn02_00414493 predicted 636
10 SASI_Rn02_00414494 predicted 923
11 SASI_Rn01_00187405 predicted 799
12 SASI_Rn01_00187406 predicted 749
13 SASI_Rn01_00187408 predicted 660
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177348 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151059 predicted 440
2 SASI_Mm01_00151060 predicted 424
3 SASI_Mm01_00151061 predicted 421
4 SASI_Mm01_00151062 predicted 207
5 SASI_Mm01_00151063 predicted 443
6 SASI_Mm01_00151064 predicted 392
7 SASI_Mm01_00151065 predicted 386
8 SASI_Mm01_00151066 predicted 235
9 SASI_Mm02_00347479 predicted 215
10 SASI_Mm01_00151068 predicted 414
11 SASI_Mm01_00151067 predicted 217
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176891
IFNE MISSION shRNA Bacterial Glycerol Stock
interferon, epsilon
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1213s21c1
Sequence:CCGGAGAGCTTACTACAGAGTTTAGCTCGAGCTAAACTCTGTAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-750s21c1
Sequence:CCGGAGTTGCAAACCTTGTCAATTCCTCGAGGAATTGACAAGGTTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1114s21c1
Sequence:CCGGGGCCATTGTCCAAGTAGAAATCTCGAGATTTCTACTTGGACAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176891.4-1284s21c1
Sequence:CCGGCATAGAGTGGTAATACAATTTCTCGAGAAATTGTATTACCACTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-683s21c1
Sequence:CCGGCTAGATTTGAAACTGATTATCCTCGAGGATAATCAGTTTCAAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1060s21c1
Sequence:CCGGCTTCCGAAGGATCCATGATTACTCGAGTAATCATGGATCCTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000364513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1025s21c1
Sequence:CCGGGGTAGTGATAACCTTAGATTACTCGAGTAATCTAAGGTTATCACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-887s21c1
Sequence:CCGGAGCCTCTTCAGGGCAAATATTCTCGAGAATATTTGCCCTGAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-318s1c1
Sequence:CCGGCCACACGGAGAAATTCCTCATCTCGAGATGAGGAATTTCTCCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-407s1c1
Sequence:CCGGCTTTGGGTAGTGATAACCTTACTCGAGTAAGGTTATCACTACCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-349s1c1
Sequence:CCGGCAACAGCTAGAATACCTAGAACTCGAGTTCTAGGTATTCTAGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-56s1c1
Sequence:CCGGCCACTATCTTCTCTCTAGATTCTCGAGAATCTAGAGAGAAGATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000005879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-241s1c1
Sequence:CCGGGCCATTCTCCATGAGATGCTTCTCGAGAAGCATCTCATGGAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176891
IFNE MISSION shRNA shRNA Plasmid DNA
interferon, epsilon
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1213s21c1
Sequence:CCGGAGAGCTTACTACAGAGTTTAGCTCGAGCTAAACTCTGTAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-750s21c1
Sequence:CCGGAGTTGCAAACCTTGTCAATTCCTCGAGGAATTGACAAGGTTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1114s21c1
Sequence:CCGGGGCCATTGTCCAAGTAGAAATCTCGAGATTTCTACTTGGACAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176891.4-1284s21c1
Sequence:CCGGCATAGAGTGGTAATACAATTTCTCGAGAAATTGTATTACCACTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-683s21c1
Sequence:CCGGCTAGATTTGAAACTGATTATCCTCGAGGATAATCAGTTTCAAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1060s21c1
Sequence:CCGGCTTCCGAAGGATCCATGATTACTCGAGTAATCATGGATCCTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000364513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1025s21c1
Sequence:CCGGGGTAGTGATAACCTTAGATTACTCGAGTAATCTAAGGTTATCACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-887s21c1
Sequence:CCGGAGCCTCTTCAGGGCAAATATTCTCGAGAATATTTGCCCTGAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-318s1c1
Sequence:CCGGCCACACGGAGAAATTCCTCATCTCGAGATGAGGAATTTCTCCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-407s1c1
Sequence:CCGGCTTTGGGTAGTGATAACCTTACTCGAGTAAGGTTATCACTACCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-349s1c1
Sequence:CCGGCAACAGCTAGAATACCTAGAACTCGAGTTCTAGGTATTCTAGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-56s1c1
Sequence:CCGGCCACTATCTTCTCTCTAGATTCTCGAGAATCTAGAGAGAAGATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000005879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-241s1c1
Sequence:CCGGGCCATTCTCCATGAGATGCTTCTCGAGAAGCATCTCATGGAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176891
IFNE MISSION shRNA Lentiviral Transduction Particles
interferon, epsilon
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369125    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1213s21c1
Sequence:CCGGAGAGCTTACTACAGAGTTTAGCTCGAGCTAAACTCTGTAGTAAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369071    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-750s21c1
Sequence:CCGGAGTTGCAAACCTTGTCAATTCCTCGAGGAATTGACAAGGTTTGCAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364512    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1114s21c1
Sequence:CCGGGGCCATTGTCCAAGTAGAAATCTCGAGATTTCTACTTGGACAATGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364515    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176891.4-1284s21c1
Sequence:CCGGCATAGAGTGGTAATACAATTTCTCGAGAAATTGTATTACCACTCTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-683s21c1
Sequence:CCGGCTAGATTTGAAACTGATTATCCTCGAGGATAATCAGTTTCAAATCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364451    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1060s21c1
Sequence:CCGGCTTCCGAAGGATCCATGATTACTCGAGTAATCATGGATCCTTCGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000364513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-1025s21c1
Sequence:CCGGGGTAGTGATAACCTTAGATTACTCGAGTAATCTAAGGTTATCACTACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369127    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_176891.4-887s21c1
Sequence:CCGGAGCCTCTTCAGGGCAAATATTCTCGAGAATATTTGCCCTGAAGAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005878    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-318s1c1
Sequence:CCGGCCACACGGAGAAATTCCTCATCTCGAGATGAGGAATTTCTCCGTGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005881    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-407s1c1
Sequence:CCGGCTTTGGGTAGTGATAACCTTACTCGAGTAAGGTTATCACTACCCAAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005882    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-349s1c1
Sequence:CCGGCAACAGCTAGAATACCTAGAACTCGAGTTCTAGGTATTCTAGCTGTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005880    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-56s1c1
Sequence:CCGGCCACTATCTTCTCTCTAGATTCTCGAGAATCTAGAGAGAAGATAGTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000005879    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_176891.2-241s1c1
Sequence:CCGGGCCATTCTCCATGAGATGCTTCTCGAGAAGCATCTCATGGAGAATGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177348
IFNE MISSION shRNA Bacterial Glycerol Stock
interferon, epsilon
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000201321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-58s1c1
Sequence:CCGGGCTCTTGGTTTCTTCCACTATCTCGAGATAGTGGAAGAAACCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-433s1c1
Sequence:CCGGGAACCTTAGGTTACAGATTAACTCGAGTTAATCTGTAACCTAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-185s1c1
Sequence:CCGGCACAGGAAGAATTTCCTGCTTCTCGAGAAGCAGGAAATTCTTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-430s1c1
Sequence:CCGGGCAGAACCTTAGGTTACAGATCTCGAGATCTGTAACCTAAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177348
IFNE MISSION shRNA shRNA Plasmid DNA
interferon, epsilon
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000201321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-58s1c1
Sequence:CCGGGCTCTTGGTTTCTTCCACTATCTCGAGATAGTGGAAGAAACCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-433s1c1
Sequence:CCGGGAACCTTAGGTTACAGATTAACTCGAGTTAATCTGTAACCTAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-185s1c1
Sequence:CCGGCACAGGAAGAATTTCCTGCTTCTCGAGAAGCAGGAAATTCTTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-430s1c1
Sequence:CCGGGCAGAACCTTAGGTTACAGATCTCGAGATCTGTAACCTAAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177348
IFNE MISSION shRNA Lentiviral Transduction Particles
interferon, epsilon
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000201321    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-58s1c1
Sequence:CCGGGCTCTTGGTTTCTTCCACTATCTCGAGATAGTGGAAGAAACCAAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200739    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-433s1c1
Sequence:CCGGGAACCTTAGGTTACAGATTAACTCGAGTTAATCTGTAACCTAAGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192358    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-185s1c1
Sequence:CCGGCACAGGAAGAATTTCCTGCTTCTCGAGAAGCAGGAAATTCTTCCTGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192709    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177348.2-430s1c1
Sequence:CCGGGCAGAACCTTAGGTTACAGATCTCGAGATCTGTAACCTAAGGTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks