EMAIL THIS PAGE TO A FRIEND

IFNL1

interferon, lambda 1

Synonyms: IL-29 IL29
Species: Human IFNL1(282618)
UniProtKB ID: Q8IU54, A0AV25, Q17R34
Gene ID:
Human(282618) Summary: This gene encodes a cytokine distantly related to type I interferons and the IL-10 family. This gene, interleukin 28A (IL28A), and interleukin 28B (IL28B) are three closely related cytokine genes that form a cytokine gene cluster on a chromosomal region mapped to 19q13. Expression of the cytokines encoded by the three genes can be induced by viral infection. All three cytokines have been shown to interact with a heterodimeric class II cytokine receptor that consists of interleukin 10 receptor, beta (IL10RB) and interleukin 28 receptor, alpha (IL28RA). [provided by RefSeq, Jul 2008]
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172140 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_172140 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_172140 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_172140 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172140 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166968 predicted 252
2 SASI_Hs01_00166969 predicted 222
3 SASI_Hs01_00166971 predicted 422
4 SASI_Hs01_00166973 predicted 250
5 SASI_Hs01_00166974 predicted 627
6 SASI_Hs01_00166975 predicted 635
7 SASI_Hs01_00166976 predicted 231
8 SASI_Hs01_00166977 predicted 624
9 SASI_Hs02_00367851 predicted 205
10 SASI_Hs01_00166970 predicted 254
11 SASI_Hs01_00166972 predicted 262
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172140
IFNL1 MISSION shRNA Bacterial Glycerol Stock
interferon, lambda 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-635s1c1
Sequence:CCGGGACCTCAAATATGTGGCCGATCTCGAGATCGGCCACATATTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-198s1c1
Sequence:CCGGGCCACATTGGCAGGTTCAAATCTCGAGATTTGAACCTGCCAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-295s1c1
Sequence:CCGGGAGTTGCAGCTCTCCTGTCTTCTCGAGAAGACAGGAGAGCTGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-172s1c1
Sequence:CCGGCAAGCCCACCACAACTGGGAACTCGAGTTCCCAGTTGTGGTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-626s1c1
Sequence:CCGGCTCACGCGAGACCTCAAATATCTCGAGATATTTGAGGTCTCGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000443162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-126s21c1
Sequence:CCGGTGACTTTGGTGCTAGGCTTGGCTCGAGCCAAGCCTAGCACCAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-233s21c1
Sequence:CCGGGAGCTAGCGAGCTTCAAGAAGCTCGAGCTTCTTGAAGCTCGCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-264s21c1
Sequence:CCGGCCTTGGAAGAGTCACTCAAGCCTCGAGGCTTGAGTGACTCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-660s21c1
Sequence:CCGGACCTGTGTCTGAGAACGTCAACTCGAGTTGACGTTCTCAGACACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172140
IFNL1 MISSION shRNA shRNA Plasmid DNA
interferon, lambda 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-635s1c1
Sequence:CCGGGACCTCAAATATGTGGCCGATCTCGAGATCGGCCACATATTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-198s1c1
Sequence:CCGGGCCACATTGGCAGGTTCAAATCTCGAGATTTGAACCTGCCAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-295s1c1
Sequence:CCGGGAGTTGCAGCTCTCCTGTCTTCTCGAGAAGACAGGAGAGCTGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-172s1c1
Sequence:CCGGCAAGCCCACCACAACTGGGAACTCGAGTTCCCAGTTGTGGTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-626s1c1
Sequence:CCGGCTCACGCGAGACCTCAAATATCTCGAGATATTTGAGGTCTCGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000443162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-126s21c1
Sequence:CCGGTGACTTTGGTGCTAGGCTTGGCTCGAGCCAAGCCTAGCACCAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-233s21c1
Sequence:CCGGGAGCTAGCGAGCTTCAAGAAGCTCGAGCTTCTTGAAGCTCGCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-264s21c1
Sequence:CCGGCCTTGGAAGAGTCACTCAAGCCTCGAGGCTTGAGTGACTCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-660s21c1
Sequence:CCGGACCTGTGTCTGAGAACGTCAACTCGAGTTGACGTTCTCAGACACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172140
IFNL1 MISSION shRNA Lentiviral Transduction Particles
interferon, lambda 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-635s1c1
Sequence:CCGGGACCTCAAATATGTGGCCGATCTCGAGATCGGCCACATATTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058244    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-198s1c1
Sequence:CCGGGCCACATTGGCAGGTTCAAATCTCGAGATTTGAACCTGCCAATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058246    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-295s1c1
Sequence:CCGGGAGTTGCAGCTCTCCTGTCTTCTCGAGAAGACAGGAGAGCTGCAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058247    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-172s1c1
Sequence:CCGGCAAGCCCACCACAACTGGGAACTCGAGTTCCCAGTTGTGGTGGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058245    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172140.1-626s1c1
Sequence:CCGGCTCACGCGAGACCTCAAATATCTCGAGATATTTGAGGTCTCGCGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000443162    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-126s21c1
Sequence:CCGGTGACTTTGGTGCTAGGCTTGGCTCGAGCCAAGCCTAGCACCAAAGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437154    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-233s21c1
Sequence:CCGGGAGCTAGCGAGCTTCAAGAAGCTCGAGCTTCTTGAAGCTCGCTAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-264s21c1
Sequence:CCGGCCTTGGAAGAGTCACTCAAGCCTCGAGGCTTGAGTGACTCTTCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415166    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172140.1-660s21c1
Sequence:CCGGACCTGTGTCTGAGAACGTCAACTCGAGTTGACGTTCTCAGACACAGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks