EMAIL THIS PAGE TO A FRIEND

IFNLR1

interferon, lambda receptor 1

Synonyms: CRF2/12 IFNLR IL-28R1 IL28RA LICR2
Gene ID:
Human(163702) Summary: The protein encoded by this gene belongs to the class II cytokine receptor family. This protein forms a receptor complex with interleukine 10 receptor, beta (IL10RB). The receptor complex has been shown to interact with three closely related cytokines, including interleukin 28A (IL28A), interleukin 28B (IL28B), and interleukin 29 (IL29). The expression of all three cytokines can be induced by viral infection. The cells overexpressing this protein have been found to have enhanced responses to IL28A and IL29, but decreased response to IL28B. Three alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
Mouse(242700) interferon lambda receptor 1
Rat(362628) interferon, lambda receptor 1
Zebrafish(100332149) interferon lambda receptor 1
domestic guinea pig(100720433) interferon, lambda receptor 1
naked mole-rat(101698624) interferon, lambda receptor 1
220 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA017319 Anti-IFNLR1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
AV48070 Anti-IL28RA antibody produced in rabbit affinity isolated antibody horse, bovine, human, rabbit
western blot pricing
SAB2101151 Anti-IL28RA antibody produced in rabbit affinity isolated antibody guinea pig, bovine, human, rat, horse, mouse, rabbit
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_170743 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_170743 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_170743 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_174851 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_174851 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_174851 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_170743 Rosetta Predictions human pricing
NM_173064 Rosetta Predictions human pricing
NM_173065 Rosetta Predictions human pricing
XM_001068423 Rosetta Predictions rat pricing
XM_342946 Rosetta Predictions rat pricing
NM_174851 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170743 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00194464 predicted 350
2 SASI_Hs01_00194465 predicted 345
3 SASI_Hs01_00194466 predicted 1550
4 SASI_Hs01_00194468 predicted 1759
5 SASI_Hs01_00194469 predicted 238
6 SASI_Hs01_00194470 predicted 1752
7 SASI_Hs01_00194471 predicted 1271
8 SASI_Hs01_00194472 predicted 221
9 SASI_Hs02_00367709 predicted 235
10 SASI_Hs02_00367710 predicted 1212
11 SASI_Hs01_00194463 predicted 1908
12 SASI_Hs01_00194467 predicted 1430
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173064 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00114527 predicted 347
2 SASI_Hs01_00114528 predicted 353
3 SASI_Hs01_00114529 predicted 1464
4 SASI_Hs01_00114531 predicted 1675
5 SASI_Hs01_00114532 predicted 229
6 SASI_Hs01_00114533 predicted 1668
7 SASI_Hs01_00114534 predicted 1184
8 SASI_Hs01_00114535 predicted 214
9 SASI_Hs02_00368056 predicted 236
10 SASI_Hs02_00368057 predicted 1122
11 SASI_Hs01_00114526 predicted 1819
12 SASI_Hs01_00114530 predicted 1333
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173065 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00166657 predicted 347
2 SASI_Hs01_00166658 predicted 344
3 SASI_Hs01_00166659 predicted 233
4 SASI_Hs01_00166661 predicted 221
5 SASI_Hs01_00166662 predicted 240
6 SASI_Hs01_00166663 predicted 1078
7 SASI_Hs01_00166664 predicted 198
8 SASI_Hs02_00368058 predicted 1023
9 SASI_Hs01_00166666 predicted 252
10 SASI_Hs02_00368059 predicted 1160
11 SASI_Hs01_00166660 predicted 1143
12 SASI_Hs01_00166665 predicted 1014
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068423 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324447 predicted 586
2 SASI_Rn02_00324448 predicted 587
3 SASI_Rn02_00324449 predicted 515
4 SASI_Rn02_00324450 predicted 1105
5 SASI_Rn02_00324451 predicted 204
6 SASI_Rn02_00324452 predicted 617
7 SASI_Rn02_00324453 predicted 690
8 SASI_Rn02_00324454 predicted 389
9 SASI_Rn02_00324455 predicted 1059
10 SASI_Rn02_00324456 predicted 211
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342946 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395091 predicted 1190
2 SASI_Rn02_00395092 predicted 1104
3 SASI_Rn02_00395093 predicted 1184
4 SASI_Rn02_00395094 predicted 1054
5 SASI_Rn02_00395095 predicted 1188
6 SASI_Rn02_00395096 predicted 1188
7 SASI_Rn02_00395097 predicted 1104
8 SASI_Rn02_00395098 predicted 1200
9 SASI_Rn02_00395099 predicted 1167
10 SASI_Rn02_00395100 predicted 1104
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174851 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00121159 predicted 1763
2 SASI_Mm01_00121160 predicted 707
3 SASI_Mm01_00121161 predicted 1832
4 SASI_Mm01_00121162 predicted 1787
5 SASI_Mm01_00121163 predicted 1728
6 SASI_Mm01_00121164 predicted 611
7 SASI_Mm01_00121165 predicted 616
8 SASI_Mm01_00121166 predicted 614
9 SASI_Mm01_00121167 predicted 1757
10 SASI_Mm01_00121168 predicted 1908
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_170743
IFNLR1 MISSION shRNA Bacterial Glycerol Stock
interferon, lambda receptor 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170743.2-2057s21c1
Sequence:CCGGCCCTAGTTAGGCCCAGATAAACTCGAGTTTATCTGGGCCTAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170743.2-1770s21c1
Sequence:CCGGCTCTTTAGGCTGAGCTATAAGCTCGAGCTTATAGCTCAGCCTAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170743.2-1465s21c1
Sequence:CCGGGGAGGCGAGGGAATCAGAAATCTCGAGATTTCTGATTCCCTCGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-1038s1c1
Sequence:CCGGCCTACATTGAACCACCTTCTTCTCGAGAAGAAGGTGGTTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-618s1c1
Sequence:CCGGACACGTTCAGTGTCCCGAAATCTCGAGATTTCGGGACACTGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-512s1c1
Sequence:CCGGGCCGGAAACAAGACCCTATTTCTCGAGAAATAGGGTCTTGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-1158s1c1
Sequence:CCGGCTTGGGATTCTTCAGACAGAACTCGAGTTCTGTCTGAAGAATCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-952s1c1
Sequence:CCGGCCAACAGACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_170743
IFNLR1 MISSION shRNA shRNA Plasmid DNA
interferon, lambda receptor 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170743.2-2057s21c1
Sequence:CCGGCCCTAGTTAGGCCCAGATAAACTCGAGTTTATCTGGGCCTAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170743.2-1770s21c1
Sequence:CCGGCTCTTTAGGCTGAGCTATAAGCTCGAGCTTATAGCTCAGCCTAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170743.2-1465s21c1
Sequence:CCGGGGAGGCGAGGGAATCAGAAATCTCGAGATTTCTGATTCCCTCGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-1038s1c1
Sequence:CCGGCCTACATTGAACCACCTTCTTCTCGAGAAGAAGGTGGTTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-618s1c1
Sequence:CCGGACACGTTCAGTGTCCCGAAATCTCGAGATTTCGGGACACTGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-512s1c1
Sequence:CCGGGCCGGAAACAAGACCCTATTTCTCGAGAAATAGGGTCTTGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-1158s1c1
Sequence:CCGGCTTGGGATTCTTCAGACAGAACTCGAGTTCTGTCTGAAGAATCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-952s1c1
Sequence:CCGGCCAACAGACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_170743
IFNLR1 MISSION shRNA Lentiviral Transduction Particles
interferon, lambda receptor 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372650    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170743.2-2057s21c1
Sequence:CCGGCCCTAGTTAGGCCCAGATAAACTCGAGTTTATCTGGGCCTAACTAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372651    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_170743.2-1770s21c1
Sequence:CCGGCTCTTTAGGCTGAGCTATAAGCTCGAGCTTATAGCTCAGCCTAAAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372589    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_170743.2-1465s21c1
Sequence:CCGGGGAGGCGAGGGAATCAGAAATCTCGAGATTTCTGATTCCCTCGCCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058988    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-1038s1c1
Sequence:CCGGCCTACATTGAACCACCTTCTTCTCGAGAAGAAGGTGGTTCAATGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-618s1c1
Sequence:CCGGACACGTTCAGTGTCCCGAAATCTCGAGATTTCGGGACACTGAACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058989    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-512s1c1
Sequence:CCGGGCCGGAAACAAGACCCTATTTCTCGAGAAATAGGGTCTTGTTTCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-1158s1c1
Sequence:CCGGCTTGGGATTCTTCAGACAGAACTCGAGTTCTGTCTGAAGAATCCCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_170743.2-952s1c1
Sequence:CCGGCCAACAGACAAGATGGAAGAACTCGAGTTCTTCCATCTTGTCTGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_174851
IFNLR1 MISSION shRNA Bacterial Glycerol Stock
interferon, lambda receptor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-896s1c1
Sequence:CCGGCCCAGAAGGAACTGACCATAACTCGAGTTATGGTCAGTTCCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-295s1c1
Sequence:CCGGTCCAAGTTCAAAGGACGAGTACTCGAGTACTCGTCCTTTGAACTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-1434s1c1
Sequence:CCGGACTGACTTTCTGCTGGGTCAACTCGAGTTGACCCAGCAGAAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-429s1c1
Sequence:CCGGCCTAAGGGTCAATGCTACCTACTCGAGTAGGTAGCATTGACCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-1201s1c1
Sequence:CCGGGACTCCTCATATAAGGATGAACTCGAGTTCATCCTTATATGAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_174851
IFNLR1 MISSION shRNA shRNA Plasmid DNA
interferon, lambda receptor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-896s1c1
Sequence:CCGGCCCAGAAGGAACTGACCATAACTCGAGTTATGGTCAGTTCCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-295s1c1
Sequence:CCGGTCCAAGTTCAAAGGACGAGTACTCGAGTACTCGTCCTTTGAACTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-1434s1c1
Sequence:CCGGACTGACTTTCTGCTGGGTCAACTCGAGTTGACCCAGCAGAAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-429s1c1
Sequence:CCGGCCTAAGGGTCAATGCTACCTACTCGAGTAGGTAGCATTGACCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-1201s1c1
Sequence:CCGGGACTCCTCATATAAGGATGAACTCGAGTTCATCCTTATATGAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_174851
IFNLR1 MISSION shRNA Lentiviral Transduction Particles
interferon, lambda receptor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066063    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-896s1c1
Sequence:CCGGCCCAGAAGGAACTGACCATAACTCGAGTTATGGTCAGTTCCTTCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-295s1c1
Sequence:CCGGTCCAAGTTCAAAGGACGAGTACTCGAGTACTCGTCCTTTGAACTTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-1434s1c1
Sequence:CCGGACTGACTTTCTGCTGGGTCAACTCGAGTTGACCCAGCAGAAAGTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-429s1c1
Sequence:CCGGCCTAAGGGTCAATGCTACCTACTCGAGTAGGTAGCATTGACCCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066064    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_174851.2-1201s1c1
Sequence:CCGGGACTCCTCATATAAGGATGAACTCGAGTTCATCCTTATATGAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks