EMAIL THIS PAGE TO A FRIEND

IFT43

intraflagellar transport 43 homolog (Chlamydomonas)

Synonyms: C14orf179 CED3
UniProtKB ID: Q96FT9, B3KPT6, B4DZI9, G3V385, O95418, Q9ULA9
Gene ID:
Human(112752) Summary: This gene encodes a subunit of the intraflagellar transport complex A (IFT-A). IFT-A is a multiprotein complex that plays an important role in cilia assembly and maintenance by mediating retrograde ciliary transport. Mutations in this gene are a cause of cranioectodermal dysplasia-3 (CED3), also known as Sensenbrenner syndrome. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]
Mouse(76411) intraflagellar transport 43 homolog (Chlamydomonas)
Rat(299209) intraflagellar transport 43 homolog (Chlamydomonas)
domestic guinea pig(100715710) intraflagellar transport 43 homolog (Chlamydomonas)
naked mole-rat(101712307) intraflagellar transport 43 homolog (Chlamydomonas)
sheep(101111886) intraflagellar transport 43 homolog (Chlamydomonas)
chicken(771922) intraflagellar transport 43 homolog (Chlamydomonas)
domestic cat(101098720) intraflagellar transport 43 homolog (Chlamydomonas)
cow(513228) intraflagellar transport 43 homolog (Chlamydomonas)
dog(480396) intraflagellar transport 43 homolog (Chlamydomonas)
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302937 ANTI-C14ORF179 (CENTER) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
flow cytometry, immunohistochemistry, western blot pricing
HPA003438 Anti-IFT43 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_052873 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052873 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052873 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001102564 Rosetta Predictions human pricing
NM_052873 Rosetta Predictions human pricing
NM_001134525 Rosetta Predictions rat pricing
NM_029601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001102564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00323243 predicted 492
2 SASI_Hs02_00323244 predicted 786
3 SASI_Hs02_00323245 predicted 233
4 SASI_Hs02_00323246 predicted 688
5 SASI_Hs02_00323247 predicted 62
6 SASI_Hs02_00323248 predicted 522
7 SASI_Hs02_00323249 predicted 305
8 SASI_Hs02_00323250 predicted 524
9 SASI_Hs02_00323251 predicted 653
10 SASI_Hs02_00323252 predicted 715
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052873 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115335 predicted 336
2 SASI_Hs02_00361574 predicted 500
3 SASI_Hs02_00361575 predicted 800
4 SASI_Hs02_00361576 predicted 696
5 SASI_Hs02_00361577 predicted 64
6 SASI_Hs02_00361578 predicted 531
7 SASI_Hs01_00115338 predicted 272
8 SASI_Hs02_00361579 predicted 539
9 SASI_Hs02_00361580 predicted 660
10 SASI_Hs02_00361581 predicted 730
11 SASI_Hs01_00115336 predicted 209
12 SASI_Hs01_00115337 predicted 251
13 SASI_Hs01_00115339 predicted 245
14 SASI_Hs01_00115340 predicted 208
15 SASI_Hs01_00115341 predicted 406
16 SASI_Hs01_00115342 predicted 438
17 SASI_Hs01_00115343 predicted 473
18 SASI_Hs01_00115344 predicted 259
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134525 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00256739 predicted 449
2 SASI_Rn02_00256740 predicted 438
3 SASI_Rn02_00256741 predicted 439
4 SASI_Rn02_00256742 predicted 409
5 SASI_Rn02_00256743 predicted 451
6 SASI_Rn02_00256744 predicted 427
7 SASI_Rn02_00256745 predicted 467
8 SASI_Rn02_00256746 predicted 576
9 SASI_Rn02_00256747 predicted 346
10 SASI_Rn02_00256748 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091218 predicted 468
2 SASI_Mm01_00091219 predicted 440
3 SASI_Mm01_00091220 predicted 207
4 SASI_Mm01_00091221 predicted 394
5 SASI_Mm01_00091222 predicted 411
6 SASI_Mm01_00091223 predicted 263
7 SASI_Mm01_00091224 predicted 345
8 SASI_Mm01_00091225 predicted 228
9 SASI_Mm01_00091226 predicted 364
10 SASI_Mm01_00091227 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029601
VALIDATED
IFT43 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 43 homolog (Chlamydomonas)
Mouse
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000438564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-479s21c1
Sequence:CCGGATGAAGTGCGAGAGGATGATGCTCGAGCATCATCCTCTCGCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-345s21c1
Sequence:CCGGTCCTCCAAGTATCCAGGTAAACTCGAGTTTACCTGGATACTTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-591s21c1
Sequence:CCGGGGGACCATCTAGGTACATCTGCTCGAGCAGATGTACCTAGATGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000422243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-369s21c1
Sequence:CCGGAGTGATGACCTACCGTGACCTCTCGAGAGGTCACGGTAGGTCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-317s21c1
Sequence:CCGGAGGAAGACTTTGTGCTACAGGCTCGAGCCTGTAGCACAAAGTCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-220s21c1
Sequence:CCGCTCCATGAAGATGGCGAATCACCTCGAGGTGATTCGCCATCTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-515s21c1
Sequence:CCGGACCATCTGTACACCGAGGTGTCTCGAGACACCTCGGTGTACAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-615s1c1
Sequence:CCGGCAGGAGCATCACTGAGCATTTCTCGAGAAATGCTCAGTGATGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-116s1c1
Sequence:CCGGCTCAGGCTGAGAATTACTTAACTCGAGTTAAGTAATTCTCAGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-618s1c1
Sequence:CCGGGAGCATCACTGAGCATTTGAACTCGAGTTCAAATGCTCAGTGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000189622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-273s1c1
Sequence:CCGGCGACGACGATATTCCTGTGATCTCGAGATCACAGGAATATCGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029601
VALIDATED
IFT43 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 43 homolog (Chlamydomonas)
Mouse
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000438564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-479s21c1
Sequence:CCGGATGAAGTGCGAGAGGATGATGCTCGAGCATCATCCTCTCGCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-345s21c1
Sequence:CCGGTCCTCCAAGTATCCAGGTAAACTCGAGTTTACCTGGATACTTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-591s21c1
Sequence:CCGGGGGACCATCTAGGTACATCTGCTCGAGCAGATGTACCTAGATGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000422243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-369s21c1
Sequence:CCGGAGTGATGACCTACCGTGACCTCTCGAGAGGTCACGGTAGGTCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-317s21c1
Sequence:CCGGAGGAAGACTTTGTGCTACAGGCTCGAGCCTGTAGCACAAAGTCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-220s21c1
Sequence:CCGCTCCATGAAGATGGCGAATCACCTCGAGGTGATTCGCCATCTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-515s21c1
Sequence:CCGGACCATCTGTACACCGAGGTGTCTCGAGACACCTCGGTGTACAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-615s1c1
Sequence:CCGGCAGGAGCATCACTGAGCATTTCTCGAGAAATGCTCAGTGATGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-116s1c1
Sequence:CCGGCTCAGGCTGAGAATTACTTAACTCGAGTTAAGTAATTCTCAGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-618s1c1
Sequence:CCGGGAGCATCACTGAGCATTTGAACTCGAGTTCAAATGCTCAGTGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000189622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-273s1c1
Sequence:CCGGCGACGACGATATTCCTGTGATCTCGAGATCACAGGAATATCGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029601
VALIDATED
IFT43 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 43 homolog (Chlamydomonas)
Mouse
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000438564    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-479s21c1
Sequence:CCGGATGAAGTGCGAGAGGATGATGCTCGAGCATCATCCTCTCGCACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417316    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-345s21c1
Sequence:CCGGTCCTCCAAGTATCCAGGTAAACTCGAGTTTACCTGGATACTTGGAGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417290    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-591s21c1
Sequence:CCGGGGGACCATCTAGGTACATCTGCTCGAGCAGATGTACCTAGATGGTCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000422243    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-369s21c1
Sequence:CCGGAGTGATGACCTACCGTGACCTCTCGAGAGGTCACGGTAGGTCATCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438077    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-317s21c1
Sequence:CCGGAGGAAGACTTTGTGCTACAGGCTCGAGCCTGTAGCACAAAGTCTTCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437634    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-220s21c1
Sequence:CCGCTCCATGAAGATGGCGAATCACCTCGAGGTGATTCGCCATCTTCATGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435790    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_029601.2-515s21c1
Sequence:CCGGACCATCTGTACACCGAGGTGTCTCGAGACACCTCGGTGTACAGATGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202015    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-615s1c1
Sequence:CCGGCAGGAGCATCACTGAGCATTTCTCGAGAAATGCTCAGTGATGCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201136    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-116s1c1
Sequence:CCGGCTCAGGCTGAGAATTACTTAACTCGAGTTAAGTAATTCTCAGCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190841    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-618s1c1
Sequence:CCGGGAGCATCACTGAGCATTTGAACTCGAGTTCAAATGCTCAGTGATGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000189622    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029601.1-273s1c1
Sequence:CCGGCGACGACGATATTCCTGTGATCTCGAGATCACAGGAATATCGTCGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052873
IFT43 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 43 homolog (Chlamydomonas)
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000369658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-374s21c1
Sequence:CCGGGTACAGGAAGAAGACTTTGTTCTCGAGAACAAAGTCTTCTTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052873.2-682s21c1
Sequence:CCGGTCACCCATGCTCTAGACATGACTCGAGTCATGTCTAGAGCATGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-410s21c1
Sequence:CCGGCCTCCCAGCATCCAGATAAAGCTCGAGCTTTATCTGGATGCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-178s21c1
Sequence:CCGGAGAGACTTCCTCTGCTAAATTCTCGAGAATTTAGCAGAGGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000263576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-329s21c1
Sequence:CCGGTCATTGGAAGAGGCAGATATTCTCGAGAATATCTGCCTCTTCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000282683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-129s21c1
Sequence:CCGGAGGCCGAGAATCACCTCAATGCTCGAGCATTGAGGTGATTCTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-276s21c1
Sequence:CCGGTGGATCTGAACGCATGCTATCCTCGAGGATAGCATGCGTTCAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-459s21c1
Sequence:CCGGATGACCTCATGAAGTACTCAGCTCGAGCTGAGTACTTCATGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-107s1c1
Sequence:CCGGGAATCACCTCAATGGCAAGAACTCGAGTTCTTGCCATTGAGGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000167648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-315s1c1
Sequence:CCGGGATATTCCTATCATTCCGGATCTCGAGATCCGGAATGATAGGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000168878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-298s1c1
Sequence:CCGGCTTCATTGGAAGAGGCAGATACTCGAGTATCTGCCTCTTCCAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052873
IFT43 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 43 homolog (Chlamydomonas)
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000369658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-374s21c1
Sequence:CCGGGTACAGGAAGAAGACTTTGTTCTCGAGAACAAAGTCTTCTTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052873.2-682s21c1
Sequence:CCGGTCACCCATGCTCTAGACATGACTCGAGTCATGTCTAGAGCATGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-410s21c1
Sequence:CCGGCCTCCCAGCATCCAGATAAAGCTCGAGCTTTATCTGGATGCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-178s21c1
Sequence:CCGGAGAGACTTCCTCTGCTAAATTCTCGAGAATTTAGCAGAGGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000263576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-329s21c1
Sequence:CCGGTCATTGGAAGAGGCAGATATTCTCGAGAATATCTGCCTCTTCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000282683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-129s21c1
Sequence:CCGGAGGCCGAGAATCACCTCAATGCTCGAGCATTGAGGTGATTCTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-276s21c1
Sequence:CCGGTGGATCTGAACGCATGCTATCCTCGAGGATAGCATGCGTTCAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-459s21c1
Sequence:CCGGATGACCTCATGAAGTACTCAGCTCGAGCTGAGTACTTCATGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-107s1c1
Sequence:CCGGGAATCACCTCAATGGCAAGAACTCGAGTTCTTGCCATTGAGGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000167648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-315s1c1
Sequence:CCGGGATATTCCTATCATTCCGGATCTCGAGATCCGGAATGATAGGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000168878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-298s1c1
Sequence:CCGGCTTCATTGGAAGAGGCAGATACTCGAGTATCTGCCTCTTCCAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052873
IFT43 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 43 homolog (Chlamydomonas)
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000369658    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-374s21c1
Sequence:CCGGGTACAGGAAGAAGACTTTGTTCTCGAGAACAAAGTCTTCTTCCTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263579    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052873.2-682s21c1
Sequence:CCGGTCACCCATGCTCTAGACATGACTCGAGTCATGTCTAGAGCATGGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-410s21c1
Sequence:CCGGCCTCCCAGCATCCAGATAAAGCTCGAGCTTTATCTGGATGCTGGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263577    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-178s21c1
Sequence:CCGGAGAGACTTCCTCTGCTAAATTCTCGAGAATTTAGCAGAGGAAGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000263576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-329s21c1
Sequence:CCGGTCATTGGAAGAGGCAGATATTCTCGAGAATATCTGCCTCTTCCAATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000282683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-129s21c1
Sequence:CCGGAGGCCGAGAATCACCTCAATGCTCGAGCATTGAGGTGATTCTCGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369603    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-276s21c1
Sequence:CCGGTGGATCTGAACGCATGCTATCCTCGAGGATAGCATGCGTTCAGATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369601    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052873.2-459s21c1
Sequence:CCGGATGACCTCATGAAGTACTCAGCTCGAGCTGAGTACTTCATGAGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168396    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-107s1c1
Sequence:CCGGGAATCACCTCAATGGCAAGAACTCGAGTTCTTGCCATTGAGGTGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000167648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-315s1c1
Sequence:CCGGGATATTCCTATCATTCCGGATCTCGAGATCCGGAATGATAGGAATATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000168878    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_052873.1-298s1c1
Sequence:CCGGCTTCATTGGAAGAGGCAGATACTCGAGTATCTGCCTCTTCCAATGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks