EMAIL THIS PAGE TO A FRIEND

IFT88

intraflagellar transport 88 homolog (Chlamydomonas)

Synonyms: D13S1056E DAF19 TG737 TTC10 hTg737
UniProtKB ID: Q13099, A2A491, B4DUS2, Q5SZJ6, Q8N719
Gene ID:
Human(8100) Summary: This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
Mouse(21821) intraflagellar transport 88
Rat(305918) intraflagellar transport 88 homolog (Chlamydomonas)
Zebrafish(321855) intraflagellar transport 88 homolog
chicken(418952) intraflagellar transport 88 homolog (Chlamydomonas)
cow(514177) intraflagellar transport 88 homolog (Chlamydomonas)
domestic cat(101083054) intraflagellar transport 88 homolog (Chlamydomonas)
dog(477345) intraflagellar transport 88 homolog (Chlamydomonas)
sheep(101118114) intraflagellar transport 88 homolog (Chlamydomonas)
Domestic Rabbit(100009576) intraflagellar transport 88 homolog (Chlamydomonas)
domestic guinea pig(100714887) intraflagellar transport 88 homolog (Chlamydomonas)
naked mole-rat(101707870) intraflagellar transport 88 homolog (Chlamydomonas)
78 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009376 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009376 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009376 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_006531 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006531 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006531 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006531 Rosetta Predictions human pricing
NM_175605 Rosetta Predictions human pricing
NM_001107266 Rosetta Predictions rat pricing
NM_009376 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006531 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00064471 predicted 1644
2 SASI_Hs01_00064472 predicted 2349
3 SASI_Hs01_00064473 predicted 1348
4 SASI_Hs01_00064474 predicted 947
5 SASI_Hs01_00064475 predicted 1896
6 SASI_Hs02_00341773 predicted 1983
7 SASI_Hs02_00341774 predicted 871
8 SASI_Hs01_00064478 predicted 390
9 SASI_Hs01_00064479 predicted 966
10 SASI_Hs02_00341775 predicted 2012
11 SASI_Hs01_00064470 predicted 2520
12 SASI_Hs01_00064476 predicted 1101
13 SASI_Hs01_00064477 predicted 1405
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197621 predicted 1875
2 SASI_Hs01_00197622 predicted 2583
3 SASI_Hs01_00197623 predicted 1575
4 SASI_Hs01_00197624 predicted 1177
5 SASI_Hs01_00197625 predicted 2125
6 SASI_Hs02_00369005 predicted 2214
7 SASI_Hs02_00369006 predicted 1095
8 SASI_Hs01_00197628 predicted 616
9 SASI_Hs01_00197629 predicted 1189
10 SASI_Hs02_00369007 predicted 2242
11 SASI_Hs01_00197620 predicted 2743
12 SASI_Hs01_00197626 predicted 1336
13 SASI_Hs01_00197627 predicted 1640
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107266 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00227145 predicted 642
2 SASI_Rn02_00227146 predicted 1777
3 SASI_Rn02_00227147 predicted 673
4 SASI_Rn02_00227148 predicted 890
5 SASI_Rn02_00227149 predicted 1882
6 SASI_Rn02_00227150 predicted 1072
7 SASI_Rn02_00227151 predicted 933
8 SASI_Rn02_00227152 predicted 1931
9 SASI_Rn02_00227153 predicted 2316
10 SASI_Rn02_00227154 predicted 507
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009376 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151435 predicted 819
2 SASI_Mm01_00151436 predicted 1775
3 SASI_Mm01_00151437 predicted 1832
4 SASI_Mm01_00151438 predicted 1881
5 SASI_Mm01_00151439 predicted 1961
6 SASI_Mm01_00151440 predicted 1624
7 SASI_Mm02_00315985 predicted 1471
8 SASI_Mm01_00151441 predicted 2229
9 SASI_Mm02_00315986 predicted 743
10 SASI_Mm01_00151442 predicted 1905
11 SASI_Mm01_00151434 predicted 2057
12 SASI_Mm01_00151443 predicted 521
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009376
VALIDATED
IFT88 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 88 homolog (Chlamydomonas)
Mouse
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000182620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009376.1-2449s1c1
Sequence:CCGGGCCCTCAGATAGAAAGACCAACTCGAGTTGGTCTTTCTATCTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000178064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009376.1-762s1c1
Sequence:CCGGGCAGGAAGACTGAAAGTGAATCTCGAGATTCACTTTCAGTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009376.1-866s1c1
Sequence:CCGGCCATAAAGAAATGAGGATCAACTCGAGTTGATCCTCATTTCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000177272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009376.1-2842s1c1
Sequence:CCGGGCCAAATAAGTCATTTACCAACTCGAGTTGGTAAATGACTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1725s1c1
Sequence:CCGGGCTCAAGTTCTTTGCCAGATACTCGAGTATCTGGCAAAGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009376.1-2760s1c1
Sequence:CCGGGCTTTCTTTAAATGGACTCTACTCGAGTAGAGTCCATTTAAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1919s1c1
Sequence:CCGGCCCTTCTAACATTGAAGTCATCTCGAGATGACTTCAATGTTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1368s1c1
Sequence:CCGGCAAGCTGTAGACACATTGAAACTCGAGTTTCAATGTGTCTACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-110s1c1
Sequence:CCGGCGACCTTTACTCTGGTTTCAACTCGAGTTGAAACCAGAGTAAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1995s21c1
Sequence:CCGGTGAATGGCTTGGAGCTTATTACTCGAGTAATAAGCTCCAAGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000338012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-988s21c1
Sequence:CCGGTCAGATGCCATCAACTCATTTCTCGAGAAATGAGTTGATGGCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1185s21c1
Sequence:CCGGCTTGCTGATTGAAGCTATAAACTCGAGTTTATAGCTTCAATCAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009376.2-2924s21c1
Sequence:CCGGGAAATTGCCTTATAAGGTAATCTCGAGATTACCTTATAAGGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000337945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1953s21c1
Sequence:CCGGCTATGAGTCATACAGGTATTTCTCGAGAAATACCTGTATGACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009376
VALIDATED
IFT88 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 88 homolog (Chlamydomonas)
Mouse
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000182620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009376.1-2449s1c1
Sequence:CCGGGCCCTCAGATAGAAAGACCAACTCGAGTTGGTCTTTCTATCTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000178064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009376.1-762s1c1
Sequence:CCGGGCAGGAAGACTGAAAGTGAATCTCGAGATTCACTTTCAGTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009376.1-866s1c1
Sequence:CCGGCCATAAAGAAATGAGGATCAACTCGAGTTGATCCTCATTTCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000177272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009376.1-2842s1c1
Sequence:CCGGGCCAAATAAGTCATTTACCAACTCGAGTTGGTAAATGACTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1725s1c1
Sequence:CCGGGCTCAAGTTCTTTGCCAGATACTCGAGTATCTGGCAAAGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009376.1-2760s1c1
Sequence:CCGGGCTTTCTTTAAATGGACTCTACTCGAGTAGAGTCCATTTAAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1919s1c1
Sequence:CCGGCCCTTCTAACATTGAAGTCATCTCGAGATGACTTCAATGTTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1368s1c1
Sequence:CCGGCAAGCTGTAGACACATTGAAACTCGAGTTTCAATGTGTCTACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-110s1c1
Sequence:CCGGCGACCTTTACTCTGGTTTCAACTCGAGTTGAAACCAGAGTAAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1995s21c1
Sequence:CCGGTGAATGGCTTGGAGCTTATTACTCGAGTAATAAGCTCCAAGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000338012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-988s21c1
Sequence:CCGGTCAGATGCCATCAACTCATTTCTCGAGAAATGAGTTGATGGCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1185s21c1
Sequence:CCGGCTTGCTGATTGAAGCTATAAACTCGAGTTTATAGCTTCAATCAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009376.2-2924s21c1
Sequence:CCGGGAAATTGCCTTATAAGGTAATCTCGAGATTACCTTATAAGGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000337945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1953s21c1
Sequence:CCGGCTATGAGTCATACAGGTATTTCTCGAGAAATACCTGTATGACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009376
VALIDATED
IFT88 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 88 homolog (Chlamydomonas)
Mouse
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000182620    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009376.1-2449s1c1
Sequence:CCGGGCCCTCAGATAGAAAGACCAACTCGAGTTGGTCTTTCTATCTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000178064    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_009376.1-762s1c1
Sequence:CCGGGCAGGAAGACTGAAAGTGAATCTCGAGATTCACTTTCAGTCTTCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176589    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009376.1-866s1c1
Sequence:CCGGCCATAAAGAAATGAGGATCAACTCGAGTTGATCCTCATTTCTTTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000177272    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009376.1-2842s1c1
Sequence:CCGGGCCAAATAAGTCATTTACCAACTCGAGTTGGTAAATGACTTATTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198449    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1725s1c1
Sequence:CCGGGCTCAAGTTCTTTGCCAGATACTCGAGTATCTGGCAAAGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197944    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_009376.1-2760s1c1
Sequence:CCGGGCTTTCTTTAAATGGACTCTACTCGAGTAGAGTCCATTTAAAGAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197452    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1919s1c1
Sequence:CCGGCCCTTCTAACATTGAAGTCATCTCGAGATGACTTCAATGTTAGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197670    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-1368s1c1
Sequence:CCGGCAAGCTGTAGACACATTGAAACTCGAGTTTCAATGTGTCTACAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198144    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_009376.1-110s1c1
Sequence:CCGGCGACCTTTACTCTGGTTTCAACTCGAGTTGAAACCAGAGTAAAGGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350890    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1995s21c1
Sequence:CCGGTGAATGGCTTGGAGCTTATTACTCGAGTAATAAGCTCCAAGCCATTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000338012    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-988s21c1
Sequence:CCGGTCAGATGCCATCAACTCATTTCTCGAGAAATGAGTTGATGGCATCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337947    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1185s21c1
Sequence:CCGGCTTGCTGATTGAAGCTATAAACTCGAGTTTATAGCTTCAATCAGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337948    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009376.2-2924s21c1
Sequence:CCGGGAAATTGCCTTATAAGGTAATCTCGAGATTACCTTATAAGGCAATTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000337945    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_009376.2-1953s21c1
Sequence:CCGGCTATGAGTCATACAGGTATTTCTCGAGAAATACCTGTATGACTCATAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006531
VALIDATED
IFT88 MISSION shRNA Bacterial Glycerol Stock
intraflagellar transport 88 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000142052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006531.2-2704s1c1
Sequence:CCGGGCCTTATGAGATCATCCTCATCTCGAGATGAGGATGATCTCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-368s1c1
Sequence:CCGGCACGGCAGTTACTAGACCTATCTCGAGATAGGTCTAGTAACTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-415s1c1
Sequence:CCGGCTCTGGCATCATCAATAGGAACTCGAGTTCCTATTGATGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-1848s1c1
Sequence:CCGGGCCGAAGTTCTTTACCAGATACTCGAGTATCTGGTAAAGAACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-1458s1c1
Sequence:CCGGGCAGTTACATACTTGAGACAACTCGAGTTGTCTCAAGTATGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000145198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-741s1c1
Sequence:CCGGGAACAAGTTACAACTCCAGAACTCGAGTTCTGGAGTTGTAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006531.2-977s1c1
Sequence:CCGGCCAAGTTCCAAGTGTCAATAACTCGAGTTATTGACACTTGGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006531.2-267s1c1
Sequence:CCGGCCAATCTATGATATCGAGGAACTCGAGTTCCTCGATATCATAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-1413s1c1
Sequence:CCGGGCTTCTCAATATGTAGAGCTACTCGAGTAGCTCTACATATTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006531
VALIDATED
IFT88 MISSION shRNA shRNA Plasmid DNA
intraflagellar transport 88 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000142052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006531.2-2704s1c1
Sequence:CCGGGCCTTATGAGATCATCCTCATCTCGAGATGAGGATGATCTCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-368s1c1
Sequence:CCGGCACGGCAGTTACTAGACCTATCTCGAGATAGGTCTAGTAACTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-415s1c1
Sequence:CCGGCTCTGGCATCATCAATAGGAACTCGAGTTCCTATTGATGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-1848s1c1
Sequence:CCGGGCCGAAGTTCTTTACCAGATACTCGAGTATCTGGTAAAGAACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-1458s1c1
Sequence:CCGGGCAGTTACATACTTGAGACAACTCGAGTTGTCTCAAGTATGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000145198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-741s1c1
Sequence:CCGGGAACAAGTTACAACTCCAGAACTCGAGTTCTGGAGTTGTAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006531.2-977s1c1
Sequence:CCGGCCAAGTTCCAAGTGTCAATAACTCGAGTTATTGACACTTGGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006531.2-267s1c1
Sequence:CCGGCCAATCTATGATATCGAGGAACTCGAGTTCCTCGATATCATAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-1413s1c1
Sequence:CCGGGCTTCTCAATATGTAGAGCTACTCGAGTAGCTCTACATATTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006531
VALIDATED
IFT88 MISSION shRNA Lentiviral Transduction Particles
intraflagellar transport 88 homolog (Chlamydomonas)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000142052    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_006531.2-2704s1c1
Sequence:CCGGGCCTTATGAGATCATCCTCATCTCGAGATGAGGATGATCTCATAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139796    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-368s1c1
Sequence:CCGGCACGGCAGTTACTAGACCTATCTCGAGATAGGTCTAGTAACTGCCGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-415s1c1
Sequence:CCGGCTCTGGCATCATCAATAGGAACTCGAGTTCCTATTGATGATGCCAGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141713    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-1848s1c1
Sequence:CCGGGCCGAAGTTCTTTACCAGATACTCGAGTATCTGGTAAAGAACTTCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145327    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-1458s1c1
Sequence:CCGGGCAGTTACATACTTGAGACAACTCGAGTTGTCTCAAGTATGTAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000145198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_006531.2-741s1c1
Sequence:CCGGGAACAAGTTACAACTCCAGAACTCGAGTTCTGGAGTTGTAACTTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144372    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_006531.2-977s1c1
Sequence:CCGGCCAAGTTCCAAGTGTCAATAACTCGAGTTATTGACACTTGGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144030    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006531.2-267s1c1
Sequence:CCGGCCAATCTATGATATCGAGGAACTCGAGTTCCTCGATATCATAGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144819    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006531.2-1413s1c1
Sequence:CCGGGCTTCTCAATATGTAGAGCTACTCGAGTAGCTCTACATATTGAGAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks