EMAIL THIS PAGE TO A FRIEND

IGF2

insulin-like growth factor 2 (somatomedin A)

Synonyms: C11orf43 IGF-II PP9974
Gene ID:
Human(3481) Summary: This gene encodes a member of the insulin family of polypeptide growth factors, which are involved in development and growth. It is an imprinted gene, expressed only from the paternal allele, and epigenetic changes at this locus are associated with Wilms tumour, Beckwith-Wiedemann syndrome, rhabdomyosarcoma, and Silver-Russell syndrome. A read-through INS-IGF2 gene exists, whose 5' region overlaps the INS gene and the 3' region overlaps this gene. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2010]
Mouse(16002) insulin-like growth factor 2
Rat(24483) insulin-like growth factor 2
Goat(100861277) insulin-like growth factor 2 (somatomedin A)
sheep(443325) insulin-like growth factor 2 (somatomedin A)
Domestic Rabbit(100328792) insulin-like growth factor 2 (somatomedin A)
domestic guinea pig(100135552) insulin-like growth factor 2 (somatomedin A)
naked mole-rat(101720309) insulin-like growth factor 2 (somatomedin A)
chicken(395097) insulin-like growth factor 2 (somatomedin A)
dog(483664) insulin-like growth factor 2 (somatomedin A)
Horse(100034182) insulin-like growth factor 2 (somatomedin A)
cow(281240) insulin-like growth factor 2 (somatomedin A)
domestic cat(101093644) insulin-like growth factor 2 (somatomedin A)
237 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406010 Anti-IGF2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA007993 Anti-IGF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
SAB1408589 Anti-IGF2 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA007556 Anti-IGF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing
I7276 Anti-Insulin-Like Growth Factor-II antibody produced in goat affinity isolated antibody, lyophilized powder human
immunohistochemistry, neutralization, western blot pricing
I2282 Anti-Insulin-Like Growth Factor-II antibody produced in goat affinity isolated antibody, lyophilized powder mouse
ELISA, neutralization, western blot pricing
I9784 Monoclonal Anti-Insulin-like Growth Factor-II antibody produced in mouse clone 75015, purified immunoglobulin, lyophilized powder human
neutralization pricing
I9659 Monoclonal Anti-Insulin-like Growth Factor-II antibody produced in mouse clone 75014, purified immunoglobulin, lyophilized powder human
western blot pricing
I9534 Monoclonal Anti-Insulin-like Growth Factor-II antibody produced in rat clone 122404, purified immunoglobulin, lyophilized powder mouse
ELISA, western blot pricing

ELISA

Product # Description Species Add to Cart
 
RAB0231 Mouse IGF-II ELISA Kit for cell culture supernatant mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010514 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010514 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010514 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_000612 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000612 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000612 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001007139 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001007139 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001007139 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000612 Rosetta Predictions human pricing
NM_001007139 Rosetta Predictions human pricing
NM_001127598 Rosetta Predictions human pricing
NM_031511 Rosetta Predictions rat pricing
NM_001122736 Rosetta Predictions mouse pricing
NM_001122737 Rosetta Predictions mouse pricing
NM_010514 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000612 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00141445 predicted 1074
2 SASI_Hs02_00302921 predicted 1179
3 SASI_Hs02_00302922 predicted 938
4 SASI_Hs02_00302923 predicted 1334
5 SASI_Hs02_00302924 predicted 1525
6 SASI_Hs02_00302925 predicted 2916
7 SASI_Hs02_00302926 predicted 2880
8 SASI_Hs02_00302927 predicted 3031
9 SASI_Hs02_00302928 predicted 2891
10 SASI_Hs02_00302929 predicted 4683
11 SASI_Hs01_00141438 predicted 736
12 SASI_Hs01_00141439 predicted 695
13 SASI_Hs01_00141440 predicted 738
14 SASI_Hs01_00141441 predicted 664
15 SASI_Hs01_00141442 predicted 738
16 SASI_Hs01_00141443 predicted 598
17 SASI_Hs01_00141444 predicted 606
18 SASI_Hs01_00141446 predicted 841
19 SASI_Hs01_00141447 predicted 790
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007139 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00305231 predicted 1056
2 SASI_Hs02_00305232 predicted 1146
3 SASI_Hs02_00305233 predicted 916
4 SASI_Hs02_00305234 predicted 1312
5 SASI_Hs02_00305235 predicted 1499
6 SASI_Hs02_00305236 predicted 2893
7 SASI_Hs02_00305237 predicted 2855
8 SASI_Hs02_00305238 predicted 3007
9 SASI_Hs02_00305239 predicted 2864
10 SASI_Hs01_00187668 predicted 4659
11 SASI_Hs01_00187666 predicted 2211
12 SASI_Hs01_00187667 predicted 2197
13 SASI_Hs01_00187669 predicted 2350
14 SASI_Hs01_00187670 predicted 2109
15 SASI_Hs01_00187671 predicted 2100
16 SASI_Hs01_00187672 predicted 2045
17 SASI_Hs01_00187673 predicted 2321
18 SASI_Hs01_00187674 predicted 2084
19 SASI_Hs01_00187675 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127598 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00329824 predicted 754
2 SASI_Hs02_00329825 predicted 849
3 SASI_Hs02_00329826 predicted 611
4 SASI_Hs02_00329827 predicted 1012
5 SASI_Hs02_00329828 predicted 369
6 SASI_Hs02_00329829 predicted 339
7 SASI_Hs02_00329830 predicted 404
8 SASI_Hs02_00329831 predicted 293
9 SASI_Hs02_00329832 predicted 414
10 SASI_Hs02_00329833 predicted 1198
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00074286 predicted 1459
2 SASI_Rn01_00074287 predicted 2134
3 SASI_Rn01_00074288 predicted 1687
4 SASI_Rn01_00074289 predicted 1405
5 SASI_Rn01_00074290 predicted 1906
6 SASI_Rn01_00074291 predicted 1987
7 SASI_Rn02_00264635 predicted 1150
8 SASI_Rn01_00074292 predicted 1662
9 SASI_Rn02_00264636 predicted 1882
10 SASI_Rn01_00074293 predicted 1672
11 SASI_Rn01_00074294 predicted 1543
12 SASI_Rn01_00074295 predicted 1600
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122736 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309301 predicted 660
2 SASI_Mm02_00309302 predicted 435
3 SASI_Mm02_00309303 predicted 650
4 SASI_Mm02_00309304 predicted 637
5 SASI_Mm02_00309305 predicted 687
6 SASI_Mm02_00309306 predicted 529
7 SASI_Mm02_00309307 predicted 386
8 SASI_Mm02_00309308 predicted 641
9 SASI_Mm02_00309309 predicted 1134
10 SASI_Mm02_00309310 predicted 865
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001122737 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309311 predicted 650
2 SASI_Mm02_00309312 predicted 424
3 SASI_Mm02_00309313 predicted 633
4 SASI_Mm02_00309314 predicted 627
5 SASI_Mm02_00309315 predicted 674
6 SASI_Mm02_00309316 predicted 526
7 SASI_Mm02_00309317 predicted 378
8 SASI_Mm02_00309318 predicted 632
9 SASI_Mm02_00309319 predicted 1124
10 SASI_Mm02_00309320 predicted 854
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010514 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00064571 predicted 999
2 SASI_Mm01_00064575 predicted 775
3 SASI_Mm01_00064576 predicted 980
4 SASI_Mm01_00064577 predicted 974
5 SASI_Mm01_00064578 predicted 1017
6 SASI_Mm01_00064579 predicted 873
7 SASI_Mm02_00318784 predicted 1316
8 SASI_Mm01_00064573 predicted 723
9 SASI_Mm01_00064574 predicted 972
10 SASI_Mm02_00318785 predicted 1194
11 SASI_Mm01_00064572 predicted 1679
12 SASI_Mm01_00064580 predicted 1666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010514
IGF2 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 (somatomedin A)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000071148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1043s1c1
Sequence:CCGGGCTTGTTGACACGCTTCAGTTCTCGAGAACTGAAGCGTGTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1263s1c1
Sequence:CCGGGTGGGCAAGTTCTTCCAATATCTCGAGATATTGGAAGAACTTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1407s1c1
Sequence:CCGGCTGATCGTGTTACCACCCAAACTCGAGTTTGGGTGGTAACACGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1373s1c1
Sequence:CCGGCAAAGAGTTCAGAGAGGCCAACTCGAGTTGGCCTCTCTGAACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000071152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1081s1c1
Sequence:CCGGGCTTCTACTTCAGCAGGCCTTCTCGAGAAGGCCTGCTGAAGTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010514
IGF2 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 (somatomedin A)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000071148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1043s1c1
Sequence:CCGGGCTTGTTGACACGCTTCAGTTCTCGAGAACTGAAGCGTGTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1263s1c1
Sequence:CCGGGTGGGCAAGTTCTTCCAATATCTCGAGATATTGGAAGAACTTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1407s1c1
Sequence:CCGGCTGATCGTGTTACCACCCAAACTCGAGTTTGGGTGGTAACACGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1373s1c1
Sequence:CCGGCAAAGAGTTCAGAGAGGCCAACTCGAGTTGGCCTCTCTGAACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000071152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1081s1c1
Sequence:CCGGGCTTCTACTTCAGCAGGCCTTCTCGAGAAGGCCTGCTGAAGTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010514
IGF2 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 (somatomedin A)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000071148    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1043s1c1
Sequence:CCGGGCTTGTTGACACGCTTCAGTTCTCGAGAACTGAAGCGTGTCAACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071149    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1263s1c1
Sequence:CCGGGTGGGCAAGTTCTTCCAATATCTCGAGATATTGGAAGAACTTGCCCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071150    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1407s1c1
Sequence:CCGGCTGATCGTGTTACCACCCAAACTCGAGTTTGGGTGGTAACACGATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071151    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1373s1c1
Sequence:CCGGCAAAGAGTTCAGAGAGGCCAACTCGAGTTGGCCTCTCTGAACTCTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000071152    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010514.1-1081s1c1
Sequence:CCGGGCTTCTACTTCAGCAGGCCTTCTCGAGAAGGCCTGCTGAAGTAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000612
IGF2 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 (somatomedin A)
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000062432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-609s1c1
Sequence:CCGGCTCGTGCTGCATTGCTGCTTACTCGAGTAAGCAGCAATGCAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-894s1c1
Sequence:CCGGCCAATATGACACCTGGAAGCACTCGAGTGCTTCCAGGTGTCATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-585s1c1
Sequence:CCGGGCTTCTCACCTTCTTGGCCTTCTCGAGAAGGCCAAGAAGGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-746s1c1
Sequence:CCGGGCATCGTTGAGGAGTGCTGTTCTCGAGAACAGCACTCCTCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000612
IGF2 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 (somatomedin A)
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000062432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-609s1c1
Sequence:CCGGCTCGTGCTGCATTGCTGCTTACTCGAGTAAGCAGCAATGCAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-894s1c1
Sequence:CCGGCCAATATGACACCTGGAAGCACTCGAGTGCTTCCAGGTGTCATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-585s1c1
Sequence:CCGGGCTTCTCACCTTCTTGGCCTTCTCGAGAAGGCCAAGAAGGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-746s1c1
Sequence:CCGGGCATCGTTGAGGAGTGCTGTTCTCGAGAACAGCACTCCTCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000612
IGF2 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 (somatomedin A)
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000062432    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-609s1c1
Sequence:CCGGCTCGTGCTGCATTGCTGCTTACTCGAGTAAGCAGCAATGCAGCACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062431    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-894s1c1
Sequence:CCGGCCAATATGACACCTGGAAGCACTCGAGTGCTTCCAGGTGTCATATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062430    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-585s1c1
Sequence:CCGGGCTTCTCACCTTCTTGGCCTTCTCGAGAAGGCCAAGAAGGTGAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000612.2-746s1c1
Sequence:CCGGGCATCGTTGAGGAGTGCTGTTCTCGAGAACAGCACTCCTCAACGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001007139
IGF2 MISSION shRNA Bacterial Glycerol Stock
insulin-like growth factor 2 (somatomedin A)
Human
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000141302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007139.1-2452s1c1
Sequence:CCGGCAAACACTGAATGTCACCTGTCTCGAGACAGGTGACATTCAGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2083s1c1
Sequence:CCGGCATTCGGAACATTGGACAGAACTCGAGTTCTGTCCAATGTTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2099s1c1
Sequence:CCGGCAGAAGCCCAAAGAGCCAAATCTCGAGATTTGGCTCTTTGGGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007139.1-2082s1c1
Sequence:CCGGCCATTCGGAACATTGGACAGACTCGAGTCTGTCCAATGTTCCGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007139.1-2450s1c1
Sequence:CCGGGCCAAACACTGAATGTCACCTCTCGAGAGGTGACATTCAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2107s1c1
Sequence:CCGGCAAAGAGCCAAATTGTCACAACTCGAGTTGTGACAATTTGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001007139
IGF2 MISSION shRNA shRNA Plasmid DNA
insulin-like growth factor 2 (somatomedin A)
Human
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000141302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007139.1-2452s1c1
Sequence:CCGGCAAACACTGAATGTCACCTGTCTCGAGACAGGTGACATTCAGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2083s1c1
Sequence:CCGGCATTCGGAACATTGGACAGAACTCGAGTTCTGTCCAATGTTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2099s1c1
Sequence:CCGGCAGAAGCCCAAAGAGCCAAATCTCGAGATTTGGCTCTTTGGGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007139.1-2082s1c1
Sequence:CCGGCCATTCGGAACATTGGACAGACTCGAGTCTGTCCAATGTTCCGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007139.1-2450s1c1
Sequence:CCGGGCCAAACACTGAATGTCACCTCTCGAGAGGTGACATTCAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2107s1c1
Sequence:CCGGCAAAGAGCCAAATTGTCACAACTCGAGTTGTGACAATTTGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001007139
IGF2 MISSION shRNA Lentiviral Transduction Particles
insulin-like growth factor 2 (somatomedin A)
Human
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000141302    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001007139.1-2452s1c1
Sequence:CCGGCAAACACTGAATGTCACCTGTCTCGAGACAGGTGACATTCAGTGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2083s1c1
Sequence:CCGGCATTCGGAACATTGGACAGAACTCGAGTTCTGTCCAATGTTCCGAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2099s1c1
Sequence:CCGGCAGAAGCCCAAAGAGCCAAATCTCGAGATTTGGCTCTTTGGGCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140308    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001007139.1-2082s1c1
Sequence:CCGGCCATTCGGAACATTGGACAGACTCGAGTCTGTCCAATGTTCCGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140389    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001007139.1-2450s1c1
Sequence:CCGGGCCAAACACTGAATGTCACCTCTCGAGAGGTGACATTCAGTGTTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144248    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_001007139.1-2107s1c1
Sequence:CCGGCAAAGAGCCAAATTGTCACAACTCGAGTTGTGACAATTTGGCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks