EMAIL THIS PAGE TO A FRIEND

IGJ

immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides

Synonyms: IGCJ JCH
UniProtKB ID: P01591
Gene ID:
Mouse(16069) immunoglobulin joining chain
Rat(360922) immunoglobulin joining chain
chicken(374117) immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
domestic cat(101085285) immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
cow(280821) immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
dog(475166) immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
sheep(101121603) immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
domestic guinea pig(100716442) immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
naked mole-rat(101717769) immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
87 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144646 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_144646 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_144646 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_152839 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_152839 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_152839 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_144646 Rosetta Predictions human pricing
XM_001081950 Rosetta Predictions rat pricing
XM_001081951 Rosetta Predictions rat pricing
XM_001081952 Rosetta Predictions rat pricing
XM_341195 Rosetta Predictions rat pricing
NM_152839 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00155799 predicted 236
2 SASI_Hs01_00155800 predicted 296
3 SASI_Hs02_00364504 predicted 275
4 SASI_Hs01_00155801 predicted 268
5 SASI_Hs01_00155802 predicted 309
6 SASI_Hs02_00364505 predicted 227
7 SASI_Hs02_00364506 predicted 232
8 SASI_Hs02_00364507 predicted 229
9 SASI_Hs01_00155807 predicted 208
10 SASI_Hs01_00155808 predicted 289
11 SASI_Hs01_00155803 predicted 415
12 SASI_Hs01_00155804 predicted 361
13 SASI_Hs01_00155805 predicted 411
14 SASI_Hs01_00155806 predicted 248
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081950 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374161 predicted 347
2 SASI_Rn02_00374162 predicted 474
3 SASI_Rn02_00374163 predicted 414
4 SASI_Rn02_00374164 predicted 475
5 SASI_Rn02_00374165 predicted 544
6 SASI_Rn02_00374166 predicted 656
7 SASI_Rn02_00374167 predicted 757
8 SASI_Rn02_00374168 predicted 472
9 SASI_Rn02_00374169 predicted 388
10 SASI_Rn02_00374170 predicted 491
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081951 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374171 predicted 535
2 SASI_Rn02_00374172 predicted 248
3 SASI_Rn02_00374173 predicted 308
4 SASI_Rn02_00374174 predicted 250
5 SASI_Rn02_00374175 predicted 322
6 SASI_Rn02_00374176 predicted 379
7 SASI_Rn02_00374177 predicted 425
8 SASI_Rn02_00374178 predicted 367
9 SASI_Rn02_00374179 predicted 413
10 SASI_Rn02_00374180 predicted 544
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001081952 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00374181 predicted 528
2 SASI_Rn02_00374182 predicted 250
3 SASI_Rn02_00374183 predicted 306
4 SASI_Rn02_00374184 predicted 245
5 SASI_Rn02_00374185 predicted 318
6 SASI_Rn02_00374186 predicted 375
7 SASI_Rn02_00374187 predicted 427
8 SASI_Rn02_00374188 predicted 368
9 SASI_Rn02_00374189 predicted 414
10 SASI_Rn02_00374190 predicted 542
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341195 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00392563 predicted 351
2 SASI_Rn02_00392564 predicted 482
3 SASI_Rn02_00392565 predicted 418
4 SASI_Rn02_00392566 predicted 476
5 SASI_Rn02_00392567 predicted 550
6 SASI_Rn02_00392568 predicted 654
7 SASI_Rn02_00392569 predicted 289
8 SASI_Rn02_00392570 predicted 762
9 SASI_Rn02_00392571 predicted 765
10 SASI_Rn02_00392572 predicted 388
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152839 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123936 predicted 302
2 SASI_Mm01_00123937 predicted 296
3 SASI_Mm01_00123938 predicted 404
4 SASI_Mm02_00342832 predicted 355
5 SASI_Mm02_00342833 predicted 291
6 SASI_Mm01_00123941 predicted 308
7 SASI_Mm01_00123943 predicted 243
8 SASI_Mm02_00342834 predicted 205
9 SASI_Mm01_00123944 predicted 265
10 SASI_Mm02_00342835 predicted 215
11 SASI_Mm01_00123935 predicted 405
12 SASI_Mm01_00123939 predicted 793
13 SASI_Mm01_00123940 predicted 441
14 SASI_Mm01_00123942 predicted 532
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144646
IGJ MISSION shRNA Bacterial Glycerol Stock
immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144646.2-423s1c1
Sequence:CCGGCTGCTACACTTATGACAGAAACTCGAGTTTCTGTCATAAGTGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144646.2-284s1c1
Sequence:CCGGCCTCACCATTGAGAACCAGATCTCGAGATCTGGTTCTCAATGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144646.2-796s1c1
Sequence:CCGGGCTCTCTTAGGAATACAGTTTCTCGAGAAACTGTATTCCTAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144646.2-202s1c1
Sequence:CCGGGAAGATCCTAATGAGGACATTCTCGAGAATGTCCTCATTAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144646.2-767s1c1
Sequence:CCGGCAATTATCATGCTCACCTGAACTCGAGTTCAGGTGAGCATGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144646.2-385s1c1
Sequence:CCGGCAGAGCAATATCTGTGATGAACTCGAGTTCATCACAGATATTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144646.3-1091s21c1
Sequence:CCGGGCATAAACATAGGTCAATTATCTCGAGATAATTGACCTATGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-311s21c1
Sequence:CCGGAGAGAAACATCCGAATTATTGCTCGAGCAATAATTCGGATGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000420868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144646.3-1069s21c1
Sequence:CCGGTCACTGTGTAGAGAACATATACTCGAGTATATGTTCTCTACACAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-604s21c1
Sequence:CCGGGCCTGCTATCCTGACTAATTTCTCGAGAAATTAGTCAGGATAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-243s21c1
Sequence:CCGGATGTAAGTGTGCCCGGATTACCTCGAGGTAATCCGGGCACACTTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144646
IGJ MISSION shRNA shRNA Plasmid DNA
immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144646.2-423s1c1
Sequence:CCGGCTGCTACACTTATGACAGAAACTCGAGTTTCTGTCATAAGTGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144646.2-284s1c1
Sequence:CCGGCCTCACCATTGAGAACCAGATCTCGAGATCTGGTTCTCAATGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144646.2-796s1c1
Sequence:CCGGGCTCTCTTAGGAATACAGTTTCTCGAGAAACTGTATTCCTAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144646.2-202s1c1
Sequence:CCGGGAAGATCCTAATGAGGACATTCTCGAGAATGTCCTCATTAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144646.2-767s1c1
Sequence:CCGGCAATTATCATGCTCACCTGAACTCGAGTTCAGGTGAGCATGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144646.2-385s1c1
Sequence:CCGGCAGAGCAATATCTGTGATGAACTCGAGTTCATCACAGATATTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144646.3-1091s21c1
Sequence:CCGGGCATAAACATAGGTCAATTATCTCGAGATAATTGACCTATGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-311s21c1
Sequence:CCGGAGAGAAACATCCGAATTATTGCTCGAGCAATAATTCGGATGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000420868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144646.3-1069s21c1
Sequence:CCGGTCACTGTGTAGAGAACATATACTCGAGTATATGTTCTCTACACAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-604s21c1
Sequence:CCGGGCCTGCTATCCTGACTAATTTCTCGAGAAATTAGTCAGGATAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-243s21c1
Sequence:CCGGATGTAAGTGTGCCCGGATTACCTCGAGGTAATCCGGGCACACTTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144646
IGJ MISSION shRNA Lentiviral Transduction Particles
immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144646.2-423s1c1
Sequence:CCGGCTGCTACACTTATGACAGAAACTCGAGTTTCTGTCATAAGTGTAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180648    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_144646.2-284s1c1
Sequence:CCGGCCTCACCATTGAGAACCAGATCTCGAGATCTGGTTCTCAATGGTGAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148227    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144646.2-796s1c1
Sequence:CCGGGCTCTCTTAGGAATACAGTTTCTCGAGAAACTGTATTCCTAAGAGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147646    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144646.2-202s1c1
Sequence:CCGGGAAGATCCTAATGAGGACATTCTCGAGAATGTCCTCATTAGGATCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147470    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_144646.2-767s1c1
Sequence:CCGGCAATTATCATGCTCACCTGAACTCGAGTTCAGGTGAGCATGATAATTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144646.2-385s1c1
Sequence:CCGGCAGAGCAATATCTGTGATGAACTCGAGTTCATCACAGATATTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435306    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144646.3-1091s21c1
Sequence:CCGGGCATAAACATAGGTCAATTATCTCGAGATAATTGACCTATGTTTATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428302    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-311s21c1
Sequence:CCGGAGAGAAACATCCGAATTATTGCTCGAGCAATAATTCGGATGTTTCTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000420868    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144646.3-1069s21c1
Sequence:CCGGTCACTGTGTAGAGAACATATACTCGAGTATATGTTCTCTACACAGTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416370    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-604s21c1
Sequence:CCGGGCCTGCTATCCTGACTAATTTCTCGAGAAATTAGTCAGGATAGCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144646.3-243s21c1
Sequence:CCGGATGTAAGTGTGCCCGGATTACCTCGAGGTAATCCGGGCACACTTACATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152839
IGJ MISSION shRNA Bacterial Glycerol Stock
immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000101225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152839.1-909s1c1
Sequence:CCGGGCCAATGAACACAGGAAGTTACTCGAGTAACTTCCTGTGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-102s1c1
Sequence:CCGGCCATTCTTGCTGACAACAAATCTCGAGATTTGTTGTCAGCAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-99s1c1
Sequence:CCGGCGACCATTCTTGCTGACAACACTCGAGTGTTGTCAGCAAGAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-133s1c1
Sequence:CCGGCCGAGTTACCTCTAGGATCATCTCGAGATGATCCTAGAGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000101227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-481s1c1
Sequence:CCGGCGATTCTTGCTACCTTGACTACTCGAGTAGTCAAGGTAGCAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152839
IGJ MISSION shRNA shRNA Plasmid DNA
immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000101225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152839.1-909s1c1
Sequence:CCGGGCCAATGAACACAGGAAGTTACTCGAGTAACTTCCTGTGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-102s1c1
Sequence:CCGGCCATTCTTGCTGACAACAAATCTCGAGATTTGTTGTCAGCAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-99s1c1
Sequence:CCGGCGACCATTCTTGCTGACAACACTCGAGTGTTGTCAGCAAGAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-133s1c1
Sequence:CCGGCCGAGTTACCTCTAGGATCATCTCGAGATGATCCTAGAGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000101227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-481s1c1
Sequence:CCGGCGATTCTTGCTACCTTGACTACTCGAGTAGTCAAGGTAGCAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152839
IGJ MISSION shRNA Lentiviral Transduction Particles
immunoglobulin J polypeptide, linker protein for immunoglobulin alpha and mu polypeptides
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000101225    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_152839.1-909s1c1
Sequence:CCGGGCCAATGAACACAGGAAGTTACTCGAGTAACTTCCTGTGTTCATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101229    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-102s1c1
Sequence:CCGGCCATTCTTGCTGACAACAAATCTCGAGATTTGTTGTCAGCAAGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-99s1c1
Sequence:CCGGCGACCATTCTTGCTGACAACACTCGAGTGTTGTCAGCAAGAATGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101226    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-133s1c1
Sequence:CCGGCCGAGTTACCTCTAGGATCATCTCGAGATGATCCTAGAGGTAACTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000101227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152839.1-481s1c1
Sequence:CCGGCGATTCTTGCTACCTTGACTACTCGAGTAGTCAAGGTAGCAAGAATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks