EMAIL THIS PAGE TO A FRIEND

IGLL1

immunoglobulin lambda-like polypeptide 1

Synonyms: 14.1 AGM2 CD179b IGL1 IGL5 IGLJ14.1 IGLL IGO IGVPB VPREB2
UniProtKB ID: P15814, Q0P681
Gene ID:
Human(3543) Summary: The preB cell receptor is found on the surface of proB and preB cells, where it is involved in transduction of signals for cellular proliferation, differentiation from the proB cell to the preB cell stage, allelic exclusion at the Ig heavy chain gene locus, and promotion of Ig light chain gene rearrangements. The preB cell receptor is composed of a membrane-bound Ig mu heavy chain in association with a heterodimeric surrogate light chain. This gene encodes one of the surrogate light chain subunits and is a member of the immunoglobulin gene superfamily. This gene does not undergo rearrangement. Mutations in this gene can result in B cell deficiency and agammaglobulinemia, an autosomal recessive disease in which few or no gamma globulins or antibodies are made. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Mouse(16136) immunoglobulin lambda-like polypeptide 1
Rat(100360919) immunoglobulin lambda-like polypeptide 1
chicken(416928) immunoglobulin lambda-like polypeptide 1
cow(789205) immunoglobulin lambda-like polypeptide 1
Domestic Rabbit(100008913) immunoglobulin lambda-like polypeptide 1
62 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_020070 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_020070 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_020070 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU148921 MISSION® esiRNA esiRNA human IGLL1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_020070 Rosetta Predictions human pricing
NM_152855 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_020070 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00104343 predicted 392
2 SASI_Hs01_00104344 predicted 386
3 SASI_Hs01_00104345 predicted 237
4 SASI_Hs01_00104346 predicted 204
5 SASI_Hs01_00104348 predicted 862
6 SASI_Hs01_00104349 predicted 860
7 SASI_Hs01_00104350 predicted 858
8 SASI_Hs01_00104347 predicted 861
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152855 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00186548 predicted 200
2 SASI_Hs01_00186549 predicted 197
3 SASI_Hs01_00186550 predicted 229
4 SASI_Hs01_00186551 predicted 230
5 SASI_Hs01_00186552 predicted 205
6 SASI_Hs01_00186554 predicted 747
7 SASI_Hs01_00186555 predicted 739
8 SASI_Hs01_00186556 predicted 738
9 SASI_Hs01_00186553 predicted 745
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_020070
IGLL1 MISSION shRNA Bacterial Glycerol Stock
immunoglobulin lambda-like polypeptide 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-487s21c1
Sequence:CCGGTGAGGAGCTCCAAGCCAACAACTCGAGTTGTTGGCTTGGAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-619s21c1
Sequence:CCGGACAGAGCAACAACAAGTACGCCTCGAGGCGTACTTGTTGTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-540s21c1
Sequence:CCGGATCCGGGAATCTTGACGGTGACTCGAGTCACCGTCAAGATTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-513s21c1
Sequence:CCGGCACTGGTGTGTCTCATGAATGCTCGAGCATTCATGAGACACACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-385s1c1
Sequence:CCGGCAAGCATAACTCAGTGACGCACTCGAGTGCGTCACTGAGTTATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-712s1c1
Sequence:CCGGCGAAGGGAGCACCGTGGAGAACTCGAGTTCTCCACGGTGCTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-402s1c1
Sequence:CCGGCGCATGTGTTTGGCAGCGGGACTCGAGTCCCGCTGCCAAACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-237s1c1
Sequence:CCGGGCCCAACAGCTGCATCGCAGACTCGAGTCTGCGATGCAGCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000057086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-594s1c1
Sequence:CCGGGCGTGGAGATGACCACGCCCTCTCGAGAGGGCGTGGTCATCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_020070
IGLL1 MISSION shRNA shRNA Plasmid DNA
immunoglobulin lambda-like polypeptide 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-487s21c1
Sequence:CCGGTGAGGAGCTCCAAGCCAACAACTCGAGTTGTTGGCTTGGAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-619s21c1
Sequence:CCGGACAGAGCAACAACAAGTACGCCTCGAGGCGTACTTGTTGTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-540s21c1
Sequence:CCGGATCCGGGAATCTTGACGGTGACTCGAGTCACCGTCAAGATTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-513s21c1
Sequence:CCGGCACTGGTGTGTCTCATGAATGCTCGAGCATTCATGAGACACACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-385s1c1
Sequence:CCGGCAAGCATAACTCAGTGACGCACTCGAGTGCGTCACTGAGTTATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-712s1c1
Sequence:CCGGCGAAGGGAGCACCGTGGAGAACTCGAGTTCTCCACGGTGCTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-402s1c1
Sequence:CCGGCGCATGTGTTTGGCAGCGGGACTCGAGTCCCGCTGCCAAACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-237s1c1
Sequence:CCGGGCCCAACAGCTGCATCGCAGACTCGAGTCTGCGATGCAGCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000057086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-594s1c1
Sequence:CCGGGCGTGGAGATGACCACGCCCTCTCGAGAGGGCGTGGTCATCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_020070
IGLL1 MISSION shRNA Lentiviral Transduction Particles
immunoglobulin lambda-like polypeptide 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372513    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-487s21c1
Sequence:CCGGTGAGGAGCTCCAAGCCAACAACTCGAGTTGTTGGCTTGGAGCTCCTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372516    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-619s21c1
Sequence:CCGGACAGAGCAACAACAAGTACGCCTCGAGGCGTACTTGTTGTTGCTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372452    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-540s21c1
Sequence:CCGGATCCGGGAATCTTGACGGTGACTCGAGTCACCGTCAAGATTCCCGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372515    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_020070.2-513s21c1
Sequence:CCGGCACTGGTGTGTCTCATGAATGCTCGAGCATTCATGAGACACACCAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057083    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-385s1c1
Sequence:CCGGCAAGCATAACTCAGTGACGCACTCGAGTGCGTCACTGAGTTATGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057084    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-712s1c1
Sequence:CCGGCGAAGGGAGCACCGTGGAGAACTCGAGTTCTCCACGGTGCTCCCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057085    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-402s1c1
Sequence:CCGGCGCATGTGTTTGGCAGCGGGACTCGAGTCCCGCTGCCAAACACATGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057087    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-237s1c1
Sequence:CCGGGCCCAACAGCTGCATCGCAGACTCGAGTCTGCGATGCAGCTGTTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000057086    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_020070.2-594s1c1
Sequence:CCGGGCGTGGAGATGACCACGCCCTCTCGAGAGGGCGTGGTCATCTCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks