EMAIL THIS PAGE TO A FRIEND

IL16

interleukin 16

Synonyms: LCF NIL16 PRIL16 prIL-16
Gene ID:
Human(3603) Summary: The protein encoded by this gene is a pleiotropic cytokine that functions as a chemoattractant, a modulator of T cell activation, and an inhibitor of HIV replication. The signaling process of this cytokine is mediated by CD4. The product of this gene undergoes proteolytic processing, which is found to yield two functional proteins. The cytokine function is exclusively attributed to the secreted C-terminal peptide, while the N-terminal product may play a role in cell cycle control. Caspase 3 is reported to be involved in the proteolytic processing of this protein. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
Mouse(16170) interleukin 16
Rat(116996) interleukin 16
naked mole-rat(101710830) interleukin 16
Goat(100860884) interleukin 16
sheep(101116938) interleukin 16
chicken(374270) interleukin 16
dog(488762) interleukin 16
domestic cat(493882) interleukin 16
cow(506314) interleukin 16
Horse(100067252) interleukin 16
Gene Class: Cytokines_and_Chemokines
185 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004513 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004513 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004513 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_010551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004513 Rosetta Predictions human pricing
NM_172217 Rosetta Predictions human pricing
NM_001105749 Rosetta Predictions rat pricing
NM_010551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004513 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00131524 predicted 337
2 SASI_Hs01_00131525 predicted 2231
3 SASI_Hs01_00131526 predicted 2214
4 SASI_Hs01_00131527 predicted 1767
5 SASI_Hs01_00131528 predicted 1290
6 SASI_Hs01_00131529 predicted 1171
7 SASI_Hs02_00337783 predicted 1848
8 SASI_Hs01_00131531 predicted 1498
9 SASI_Hs01_00131532 predicted 1012
10 SASI_Hs02_00337784 predicted 2035
11 SASI_Hs01_00131530 predicted 305
12 SASI_Hs01_00131533 predicted 1359
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172217 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00110800 predicted 2516
2 SASI_Hs02_00367926 predicted 4405
3 SASI_Hs02_00367927 predicted 4392
4 SASI_Hs01_00110801 predicted 3947
5 SASI_Hs01_00110802 predicted 3469
6 SASI_Hs01_00110803 predicted 3351
7 SASI_Hs02_00367928 predicted 4030
8 SASI_Hs01_00110805 predicted 3671
9 SASI_Hs01_00110806 predicted 3196
10 SASI_Hs02_00367929 predicted 4215
11 SASI_Hs01_00110799 predicted 3276
12 SASI_Hs01_00110804 predicted 2238
13 SASI_Hs01_00110807 predicted 3290
14 SASI_Hs01_00110808 predicted 3717
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001105749 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00212156 predicted 2351
2 SASI_Rn02_00212157 predicted 3644
3 SASI_Rn02_00212158 predicted 3665
4 SASI_Rn02_00212159 predicted 2371
5 SASI_Rn02_00212160 predicted 896
6 SASI_Rn02_00212161 predicted 3154
7 SASI_Rn02_00212162 predicted 3451
8 SASI_Rn02_00212163 predicted 232
9 SASI_Rn02_00212164 predicted 2622
10 SASI_Rn02_00212165 predicted 1010
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318814 predicted 4097
2 SASI_Mm01_00064948 predicted 3147
3 SASI_Mm01_00064949 predicted 3663
4 SASI_Mm01_00064951 predicted 3114
5 SASI_Mm01_00064952 predicted 981
6 SASI_Mm01_00064955 predicted 2988
7 SASI_Mm01_00064956 predicted 899
8 SASI_Mm01_00064957 predicted 2875
9 SASI_Mm02_00318815 predicted 1006
10 SASI_Mm02_00318816 predicted 3631
11 SASI_Mm01_00064950 predicted 2380
12 SASI_Mm01_00064953 predicted 2297
13 SASI_Mm01_00064954 predicted 1005
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004513
IL16 MISSION shRNA Bacterial Glycerol Stock
interleukin 16
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000443367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004513.5-2585s21c1
Sequence:CCGGTGGGACCACGTGAGATCATTCCTCGAGGAATGATCTCACGTGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004513.5-2468s21c1
Sequence:CCGGCCCAAACAGTGACATTTATTTCTCGAGAAATAAATGTCACTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004513.5-1408s21c1
Sequence:CCGGGTTCTGGATGAAGCAACATTACTCGAGTAATGTTGCTTCATCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-491s1c1
Sequence:CCGGCCAATGGCACTCCCAAAGTTTCTCGAGAAACTTTGGGAGTGCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1619s1c1
Sequence:CCGGCGGTTCACAGAGTGTTTCCAACTCGAGTTGGAAACACTCTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1978s1c1
Sequence:CCGGCCTCTCACCATTAACAGGATTCTCGAGAATCCTGTTAATGGTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1856s1c1
Sequence:CCGGCCAGTGATGTTTCTGTAGAATCTCGAGATTCTACAGAAACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1206s1c1
Sequence:CCGGGCTGTGCCTTCCATCTTCTATCTCGAGATAGAAGATGGAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004513
IL16 MISSION shRNA shRNA Plasmid DNA
interleukin 16
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000443367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004513.5-2585s21c1
Sequence:CCGGTGGGACCACGTGAGATCATTCCTCGAGGAATGATCTCACGTGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004513.5-2468s21c1
Sequence:CCGGCCCAAACAGTGACATTTATTTCTCGAGAAATAAATGTCACTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004513.5-1408s21c1
Sequence:CCGGGTTCTGGATGAAGCAACATTACTCGAGTAATGTTGCTTCATCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-491s1c1
Sequence:CCGGCCAATGGCACTCCCAAAGTTTCTCGAGAAACTTTGGGAGTGCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1619s1c1
Sequence:CCGGCGGTTCACAGAGTGTTTCCAACTCGAGTTGGAAACACTCTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1978s1c1
Sequence:CCGGCCTCTCACCATTAACAGGATTCTCGAGAATCCTGTTAATGGTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1856s1c1
Sequence:CCGGCCAGTGATGTTTCTGTAGAATCTCGAGATTCTACAGAAACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1206s1c1
Sequence:CCGGGCTGTGCCTTCCATCTTCTATCTCGAGATAGAAGATGGAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004513
IL16 MISSION shRNA Lentiviral Transduction Particles
interleukin 16
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000443367    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004513.5-2585s21c1
Sequence:CCGGTGGGACCACGTGAGATCATTCCTCGAGGAATGATCTCACGTGGTCCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004513.5-2468s21c1
Sequence:CCGGCCCAAACAGTGACATTTATTTCTCGAGAAATAAATGTCACTGTTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413562    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004513.5-1408s21c1
Sequence:CCGGGTTCTGGATGAAGCAACATTACTCGAGTAATGTTGCTTCATCCAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059130    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-491s1c1
Sequence:CCGGCCAATGGCACTCCCAAAGTTTCTCGAGAAACTTTGGGAGTGCCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059131    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1619s1c1
Sequence:CCGGCGGTTCACAGAGTGTTTCCAACTCGAGTTGGAAACACTCTGTGAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059129    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1978s1c1
Sequence:CCGGCCTCTCACCATTAACAGGATTCTCGAGAATCCTGTTAATGGTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059128    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1856s1c1
Sequence:CCGGCCAGTGATGTTTCTGTAGAATCTCGAGATTCTACAGAAACATCACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059132    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004513.3-1206s1c1
Sequence:CCGGGCTGTGCCTTCCATCTTCTATCTCGAGATAGAAGATGGAAGGCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010551
IL16 MISSION shRNA Bacterial Glycerol Stock
interleukin 16
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010551.2-4756s1c1
Sequence:CCGGGCCTTTGAAGACTCATAACATCTCGAGATGTTATGAGTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-1430s1c1
Sequence:CCGGCCTGACTCTCAATGAAGTCTACTCGAGTAGACTTCATTGAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-3947s1c1
Sequence:CCGGGCCTCTTACCATAAACAGGATCTCGAGATCCTGTTTATGGTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-3149s1c1
Sequence:CCGGCCAGCTATCATCTGCTGTCATCTCGAGATGACAGCAGATGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-891s1c1
Sequence:CCGGGACAGCATTTACGGCCCTATTCTCGAGAATAGGGCCGTAAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010551
IL16 MISSION shRNA shRNA Plasmid DNA
interleukin 16
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010551.2-4756s1c1
Sequence:CCGGGCCTTTGAAGACTCATAACATCTCGAGATGTTATGAGTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-1430s1c1
Sequence:CCGGCCTGACTCTCAATGAAGTCTACTCGAGTAGACTTCATTGAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-3947s1c1
Sequence:CCGGGCCTCTTACCATAAACAGGATCTCGAGATCCTGTTTATGGTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-3149s1c1
Sequence:CCGGCCAGCTATCATCTGCTGTCATCTCGAGATGACAGCAGATGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-891s1c1
Sequence:CCGGGACAGCATTTACGGCCCTATTCTCGAGAATAGGGCCGTAAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010551
IL16 MISSION shRNA Lentiviral Transduction Particles
interleukin 16
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066498    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010551.2-4756s1c1
Sequence:CCGGGCCTTTGAAGACTCATAACATCTCGAGATGTTATGAGTCTTCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066499    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-1430s1c1
Sequence:CCGGCCTGACTCTCAATGAAGTCTACTCGAGTAGACTTCATTGAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066502    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-3947s1c1
Sequence:CCGGGCCTCTTACCATAAACAGGATCTCGAGATCCTGTTTATGGTAAGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066501    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-3149s1c1
Sequence:CCGGCCAGCTATCATCTGCTGTCATCTCGAGATGACAGCAGATGATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066500    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010551.2-891s1c1
Sequence:CCGGGACAGCATTTACGGCCCTATTCTCGAGAATAGGGCCGTAAATGCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks