EMAIL THIS PAGE TO A FRIEND

IL17A

interleukin 17A

Synonyms: CTLA8 IL-17 IL-17A IL17
UniProtKB ID: Q16552, Q5T2P0
Gene ID:
Human(3605) Summary: The protein encoded by this gene is a proinflammatory cytokine produced by activated T cells. This cytokine regulates the activities of NF-kappaB and mitogen-activated protein kinases. This cytokine can stimulate the expression of IL6 and cyclooxygenase-2 (PTGS2/COX-2), as well as enhance the production of nitric oxide (NO). High levels of this cytokine are associated with several chronic inflammatory diseases including rheumatoid arthritis, psoriasis and multiple sclerosis. [provided by RefSeq, Jul 2008]
Mouse(16171) interleukin 17A
Rat(301289) interleukin 17A
domestic cat(101095339) interleukin 17A
cow(282863) interleukin 17A
Horse(100034142) interleukin 17A
dog(481837) interleukin 17A
Goat(100860877) interleukin 17A
sheep(101103931) interleukin 17A
naked mole-rat(101719364) interleukin 17A
96 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010552 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010552 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010552 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002190 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002190 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002190 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002190 Rosetta Predictions human pricing
NM_001106897 Rosetta Predictions rat pricing
NM_010552 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002190 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00207211 predicted 665
2 SASI_Hs01_00207212 predicted 715
3 SASI_Hs01_00207213 predicted 286
4 SASI_Hs01_00207214 predicted 1011
5 SASI_Hs01_00207215 predicted 609
6 SASI_Hs01_00207216 predicted 728
7 SASI_Hs01_00207218 predicted 980
8 SASI_Hs01_00207219 predicted 257
9 SASI_Hs01_00207220 predicted 935
10 SASI_Hs02_00333408 predicted 637
11 SASI_Hs01_00207217 predicted 912
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106897 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223486 predicted 754
2 SASI_Rn02_00223487 predicted 565
3 SASI_Rn02_00223488 predicted 577
4 SASI_Rn02_00223489 predicted 693
5 SASI_Rn02_00223490 predicted 306
6 SASI_Rn02_00223491 predicted 882
7 SASI_Rn02_00223492 predicted 214
8 SASI_Rn02_00223493 predicted 384
9 SASI_Rn02_00223494 predicted 778
10 SASI_Rn02_00223495 predicted 251
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010552 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00116042 predicted 211
2 SASI_Mm01_00116043 predicted 599
3 SASI_Mm01_00116045 predicted 358
4 SASI_Mm01_00116046 predicted 357
5 SASI_Mm01_00116047 predicted 300
6 SASI_Mm01_00116048 predicted 298
7 SASI_Mm01_00116049 predicted 306
8 SASI_Mm01_00116050 predicted 281
9 SASI_Mm02_00318817 predicted 455
10 SASI_Mm01_00116051 predicted 879
11 SASI_Mm01_00116044 predicted 872
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010552
IL17A MISSION shRNA Bacterial Glycerol Stock
interleukin 17A
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000066719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-187s1c1
Sequence:CCGGCCTCCAGAATGTGAAGGTCAACTCGAGTTGACCTTCACATTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-297s1c1
Sequence:CCGGACCGCAATGAAGACCCTGATACTCGAGTATCAGGGTCTTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-457s1c1
Sequence:CCGGCTTCACTTTCAGGGTCGAGAACTCGAGTTCTCGACCCTGAAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-391s1c1
Sequence:CCGGCCACATGAATTCTGTTCTCATCTCGAGATGAGAACAGAATTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010552
IL17A MISSION shRNA shRNA Plasmid DNA
interleukin 17A
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000066719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-187s1c1
Sequence:CCGGCCTCCAGAATGTGAAGGTCAACTCGAGTTGACCTTCACATTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-297s1c1
Sequence:CCGGACCGCAATGAAGACCCTGATACTCGAGTATCAGGGTCTTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-457s1c1
Sequence:CCGGCTTCACTTTCAGGGTCGAGAACTCGAGTTCTCGACCCTGAAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-391s1c1
Sequence:CCGGCCACATGAATTCTGTTCTCATCTCGAGATGAGAACAGAATTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010552
IL17A MISSION shRNA Lentiviral Transduction Particles
interleukin 17A
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000066719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-187s1c1
Sequence:CCGGCCTCCAGAATGTGAAGGTCAACTCGAGTTGACCTTCACATTCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-297s1c1
Sequence:CCGGACCGCAATGAAGACCCTGATACTCGAGTATCAGGGTCTTCATTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-457s1c1
Sequence:CCGGCTTCACTTTCAGGGTCGAGAACTCGAGTTCTCGACCCTGAAAGTGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010552.2-391s1c1
Sequence:CCGGCCACATGAATTCTGTTCTCATCTCGAGATGAGAACAGAATTCATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002190
IL17A MISSION shRNA Bacterial Glycerol Stock
interleukin 17A
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000048728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-233s1c1
Sequence:CCGGCCTCAGATTACTACAACCGATCTCGAGATCGGTTGTAGTAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-114s1c1
Sequence:CCGGAGGAATCACAATCCCACGAAACTCGAGTTTCGTGGGATTGTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-144s1c1
Sequence:CCGGCCCAAATTCTGAGGACAAGAACTCGAGTTCTTGTCCTCAGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-207s1c1
Sequence:CCGGGAATACCAATACCAATCCCAACTCGAGTTGGGATTGGTATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000048730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-357s1c1
Sequence:CCGGGAACGTGGACTACCACATGAACTCGAGTTCATGTGGTAGTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002190.2-983s21c1
Sequence:CCGGATCAGTTCTGCCTAGGTAAATCTCGAGATTTACCTAGGCAGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002190.2-924s21c1
Sequence:CCGGGAGCTATTTAAGGATCTATTTCTCGAGAAATAGATCCTTAAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002190.2-183s21c1
Sequence:CCGGGGTCAACCTGAACATCCATAACTCGAGTTATGGATGTTCAGGTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002190
IL17A MISSION shRNA shRNA Plasmid DNA
interleukin 17A
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000048728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-233s1c1
Sequence:CCGGCCTCAGATTACTACAACCGATCTCGAGATCGGTTGTAGTAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-114s1c1
Sequence:CCGGAGGAATCACAATCCCACGAAACTCGAGTTTCGTGGGATTGTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-144s1c1
Sequence:CCGGCCCAAATTCTGAGGACAAGAACTCGAGTTCTTGTCCTCAGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-207s1c1
Sequence:CCGGGAATACCAATACCAATCCCAACTCGAGTTGGGATTGGTATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000048730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-357s1c1
Sequence:CCGGGAACGTGGACTACCACATGAACTCGAGTTCATGTGGTAGTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002190.2-983s21c1
Sequence:CCGGATCAGTTCTGCCTAGGTAAATCTCGAGATTTACCTAGGCAGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002190.2-924s21c1
Sequence:CCGGGAGCTATTTAAGGATCTATTTCTCGAGAAATAGATCCTTAAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002190.2-183s21c1
Sequence:CCGGGGTCAACCTGAACATCCATAACTCGAGTTATGGATGTTCAGGTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002190
IL17A MISSION shRNA Lentiviral Transduction Particles
interleukin 17A
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000048728    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-233s1c1
Sequence:CCGGCCTCAGATTACTACAACCGATCTCGAGATCGGTTGTAGTAATCTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048732    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-114s1c1
Sequence:CCGGAGGAATCACAATCCCACGAAACTCGAGTTTCGTGGGATTGTGATTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048729    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-144s1c1
Sequence:CCGGCCCAAATTCTGAGGACAAGAACTCGAGTTCTTGTCCTCAGAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048731    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-207s1c1
Sequence:CCGGGAATACCAATACCAATCCCAACTCGAGTTGGGATTGGTATTGGTATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000048730    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002190.2-357s1c1
Sequence:CCGGGAACGTGGACTACCACATGAACTCGAGTTCATGTGGTAGTCCACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372537    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002190.2-983s21c1
Sequence:CCGGATCAGTTCTGCCTAGGTAAATCTCGAGATTTACCTAGGCAGAACTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372538    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_002190.2-924s21c1
Sequence:CCGGGAGCTATTTAAGGATCTATTTCTCGAGAAATAGATCCTTAAATAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372470    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_002190.2-183s21c1
Sequence:CCGGGGTCAACCTGAACATCCATAACTCGAGTTATGGATGTTCAGGTTGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks