EMAIL THIS PAGE TO A FRIEND

IL17RC

interleukin 17 receptor C

Synonyms: IL17-RL IL17RL
Gene ID:
Human(84818) Summary: This gene encodes a single-pass type I membrane protein that shares similarity with the interleukin-17 receptor (IL-17RA). Unlike IL-17RA, which is predominantly expressed in hemopoietic cells, and binds with high affinity to only IL-17A, this protein is expressed in nonhemopoietic tissues, and binds both IL-17A and IL-17F with similar affinities. The proinflammatory cytokines, IL-17A and IL-17F, have been implicated in the progression of inflammatory and autoimmune diseases. Multiple alternatively spliced transcript variants encoding different isoforms have been detected for this gene, and it has been proposed that soluble, secreted proteins lacking transmembrane and intracellular domains may function as extracellular antagonists to cytokine signaling. [provided by RefSeq, Feb 2011]
Mouse(171095) interleukin 17 receptor C
Rat(297520) interleukin 17 receptor C
domestic cat(101092091) interleukin 17 receptor C
cow(504855) interleukin 17 receptor C
Horse(100058271) interleukin 17 receptor C
dog(610118) interleukin 17 receptor C
domestic guinea pig(100730048) interleukin 17 receptor C
naked mole-rat(101701402) interleukin 17 receptor C
sheep(101123416) interleukin 17 receptor C
Domestic Rabbit(100350539) interleukin 17 receptor C
80 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_032732 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032732 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032732 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_134159 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_134159 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_134159 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU090471 MISSION® esiRNA esiRNA human IL17RC (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032732 Rosetta Predictions human pricing
NM_153460 Rosetta Predictions human pricing
NM_153461 Rosetta Predictions human pricing
XM_001078782 Rosetta Predictions rat pricing
XM_216240 Rosetta Predictions rat pricing
NM_134159 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032732 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024466 predicted 1234
2 SASI_Hs01_00024467 predicted 1002
3 SASI_Hs01_00024468 predicted 1417
4 SASI_Hs01_00024469 predicted 1258
5 SASI_Hs01_00024471 predicted 1008
6 SASI_Hs02_00360271 predicted 1349
7 SASI_Hs01_00024473 predicted 1196
8 SASI_Hs02_00360272 predicted 1203
9 SASI_Hs01_00024474 predicted 1212
10 SASI_Hs01_00024475 predicted 1273
11 SASI_Hs01_00024470 predicted 1213
12 SASI_Hs01_00024472 predicted 1351
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153460 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00219532 predicted 1278
2 SASI_Hs01_00219533 predicted 1048
3 SASI_Hs01_00219534 predicted 1454
4 SASI_Hs01_00219535 predicted 1302
5 SASI_Hs01_00219537 predicted 1053
6 SASI_Hs02_00367298 predicted 1391
7 SASI_Hs01_00219539 predicted 1242
8 SASI_Hs02_00367299 predicted 1249
9 SASI_Hs01_00219540 predicted 1262
10 SASI_Hs01_00219541 predicted 1325
11 SASI_Hs01_00219536 predicted 1260
12 SASI_Hs01_00219538 predicted 1406
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00146056 predicted 1488
2 SASI_Hs01_00146057 predicted 1268
3 SASI_Hs01_00146058 predicted 1671
4 SASI_Hs01_00146059 predicted 1516
5 SASI_Hs01_00146061 predicted 1274
6 SASI_Hs02_00367300 predicted 1601
7 SASI_Hs01_00146063 predicted 1452
8 SASI_Hs02_00367301 predicted 1454
9 SASI_Hs01_00146064 predicted 1469
10 SASI_Hs01_00146065 predicted 1536
11 SASI_Hs01_00146060 predicted 1471
12 SASI_Hs01_00146062 predicted 1610
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001078782 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00361963 predicted 668
2 SASI_Rn02_00361964 predicted 900
3 SASI_Rn02_00361965 predicted 859
4 SASI_Rn02_00361966 predicted 409
5 SASI_Rn02_00361967 predicted 1205
6 SASI_Rn02_00361968 predicted 2012
7 SASI_Rn02_00361969 predicted 1212
8 SASI_Rn02_00361970 predicted 901
9 SASI_Rn02_00361971 predicted 848
10 SASI_Rn02_00361972 predicted 1202
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_216240 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00376490 predicted 1966
2 SASI_Rn02_00376491 predicted 1704
3 SASI_Rn02_00376492 predicted 2133
4 SASI_Rn02_00376493 predicted 1891
5 SASI_Rn02_00376494 predicted 2016
6 SASI_Rn02_00376495 predicted 1866
7 SASI_Rn02_00376496 predicted 1761
8 SASI_Rn02_00376497 predicted 1787
9 SASI_Rn02_00376498 predicted 1839
10 SASI_Rn02_00376499 predicted 1825
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_134159 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172242 predicted 789
2 SASI_Mm01_00172243 predicted 1069
3 SASI_Mm01_00172245 predicted 755
4 SASI_Mm01_00172246 predicted 1234
5 SASI_Mm01_00172247 predicted 1370
6 SASI_Mm01_00172248 predicted 1197
7 SASI_Mm01_00172249 predicted 896
8 SASI_Mm01_00172250 predicted 1145
9 SASI_Mm02_00339424 predicted 1141
10 SASI_Mm01_00172251 predicted 333
11 SASI_Mm01_00172244 predicted 324
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032732
VALIDATED
IL17RC MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-696s21c1
Sequence:CCGGTCTGTGGGCTCTGTGGTATATCTCGAGATATACCACAGAGCCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-990s21c1
Sequence:CCGGCTGGTTCCCTGCCTCTGTATTCTCGAGAATACAGAGGCAGGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-1258s21c1
Sequence:CCGGTCGAGTTCCCATTGCTGAAAGCTCGAGCTTTCAGCAATGGGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-1341s1c1
Sequence:CCGGCCTCTCAAAGACGATGTGCTACTCGAGTAGCACATCGTCTTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032732.2-1461s1c1
Sequence:CCGGCGCCTTGGAGAGTACTTACTACTCGAGTAGTAAGTACTCTCCAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-944s1c1
Sequence:CCGGGCAGATCATTACCTTGAACCACTCGAGTGGTTCAAGGTAATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-1550s1c1
Sequence:CCGGCATGGACAAATACATCCACAACTCGAGTTGTGGATGTATTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032732.2-726s1c1
Sequence:CCGGGAGGTACGAATCTGGTCCTATCTCGAGATAGGACCAGATTCGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032732
VALIDATED
IL17RC MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-696s21c1
Sequence:CCGGTCTGTGGGCTCTGTGGTATATCTCGAGATATACCACAGAGCCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-990s21c1
Sequence:CCGGCTGGTTCCCTGCCTCTGTATTCTCGAGAATACAGAGGCAGGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-1258s21c1
Sequence:CCGGTCGAGTTCCCATTGCTGAAAGCTCGAGCTTTCAGCAATGGGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-1341s1c1
Sequence:CCGGCCTCTCAAAGACGATGTGCTACTCGAGTAGCACATCGTCTTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032732.2-1461s1c1
Sequence:CCGGCGCCTTGGAGAGTACTTACTACTCGAGTAGTAAGTACTCTCCAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-944s1c1
Sequence:CCGGGCAGATCATTACCTTGAACCACTCGAGTGGTTCAAGGTAATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-1550s1c1
Sequence:CCGGCATGGACAAATACATCCACAACTCGAGTTGTGGATGTATTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032732.2-726s1c1
Sequence:CCGGGAGGTACGAATCTGGTCCTATCTCGAGATAGGACCAGATTCGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032732
VALIDATED
IL17RC MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-696s21c1
Sequence:CCGGTCTGTGGGCTCTGTGGTATATCTCGAGATATACCACAGAGCCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372552    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-990s21c1
Sequence:CCGGCTGGTTCCCTGCCTCTGTATTCTCGAGAATACAGAGGCAGGGAACCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372553    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: MCH58
TRC Version: 2 Clone ID:NM_032732.4-1258s21c1
Sequence:CCGGTCGAGTTCCCATTGCTGAAAGCTCGAGCTTTCAGCAATGGGAACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-1341s1c1
Sequence:CCGGCCTCTCAAAGACGATGTGCTACTCGAGTAGCACATCGTCTTTGAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058871    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032732.2-1461s1c1
Sequence:CCGGCGCCTTGGAGAGTACTTACTACTCGAGTAGTAAGTACTCTCCAAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-944s1c1
Sequence:CCGGGCAGATCATTACCTTGAACCACTCGAGTGGTTCAAGGTAATGATCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032732.2-1550s1c1
Sequence:CCGGCATGGACAAATACATCCACAACTCGAGTTGTGGATGTATTTGTCCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058869    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_032732.2-726s1c1
Sequence:CCGGGAGGTACGAATCTGGTCCTATCTCGAGATAGGACCAGATTCGTACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_134159
VALIDATED
IL17RC MISSION shRNA Bacterial Glycerol Stock
interleukin 17 receptor C
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000066993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1363s1c1
Sequence:CCGGGCTGTGGAACGATGACAACATCTCGAGATGTTGTCATCGTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-413s1c1
Sequence:CCGGGCTGGAAAGTCTGATTCAGAACTCGAGTTCTGAATCAGACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1711s1c1
Sequence:CCGGTGGCGTGGTAATCCTTCTCTTCTCGAGAAGAGAAGGATTACCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134159.2-671s1c1
Sequence:CCGGCCTGATGGTGACAATGTCCTTCTCGAGAAGGACATTGTCACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1087s1c1
Sequence:CCGGGCCACAAGATTTCCAGTTGGTCTCGAGACCAACTGGAAATCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_134159
VALIDATED
IL17RC MISSION shRNA shRNA Plasmid DNA
interleukin 17 receptor C
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000066993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1363s1c1
Sequence:CCGGGCTGTGGAACGATGACAACATCTCGAGATGTTGTCATCGTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-413s1c1
Sequence:CCGGGCTGGAAAGTCTGATTCAGAACTCGAGTTCTGAATCAGACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1711s1c1
Sequence:CCGGTGGCGTGGTAATCCTTCTCTTCTCGAGAAGAGAAGGATTACCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134159.2-671s1c1
Sequence:CCGGCCTGATGGTGACAATGTCCTTCTCGAGAAGGACATTGTCACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1087s1c1
Sequence:CCGGGCCACAAGATTTCCAGTTGGTCTCGAGACCAACTGGAAATCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_134159
VALIDATED
IL17RC MISSION shRNA Lentiviral Transduction Particles
interleukin 17 receptor C
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000066993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1363s1c1
Sequence:CCGGGCTGTGGAACGATGACAACATCTCGAGATGTTGTCATCGTTCCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066994    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-413s1c1
Sequence:CCGGGCTGGAAAGTCTGATTCAGAACTCGAGTTCTGAATCAGACTTTCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066995    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1711s1c1
Sequence:CCGGTGGCGTGGTAATCCTTCTCTTCTCGAGAAGAGAAGGATTACCACGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066996    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_134159.2-671s1c1
Sequence:CCGGCCTGATGGTGACAATGTCCTTCTCGAGAAGGACATTGTCACCATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066997    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_134159.2-1087s1c1
Sequence:CCGGGCCACAAGATTTCCAGTTGGTCTCGAGACCAACTGGAAATCTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks