EMAIL THIS PAGE TO A FRIEND

IL1R1

interleukin 1 receptor, type I

Synonyms: CD121A D2S1473 IL-1R-alpha IL1R IL1RA P80
UniProtKB ID: P14778, Q587I7
Gene ID:
Human(3554) Summary: The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein is a receptor for interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA). It is an important mediator involved in many cytokine induced immune and inflammatory responses. This gene along with interleukin 1 receptor, type II (IL1R2), interleukin 1 receptor-like 2 (IL1RL2), and interleukin 1 receptor-like 1 (IL1RL1) form a cytokine receptor gene cluster in a region mapped to chromosome 2q12. [provided by RefSeq, Jul 2008]
Mouse(16177) interleukin 1 receptor, type I
Rat(25663) interleukin 1 receptor, type I
sheep(101103054) interleukin 1 receptor, type I
Domestic Rabbit(100009558) interleukin 1 receptor, type I
domestic guinea pig(100724206) interleukin 1 receptor, type I
naked mole-rat(101711273) interleukin 1 receptor, type I
chicken(396481) interleukin 1 receptor, type I
cow(515640) interleukin 1 receptor, type I
Horse(100009699) interleukin 1 receptor, type I
domestic cat(101080705) interleukin 1 receptor, type I
dog(481328) interleukin 1 receptor, type I
106 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000877 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008362 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008362 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008362 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000877 Rosetta Predictions human pricing
NM_013123 Rosetta Predictions rat pricing
NM_001123382 Rosetta Predictions mouse pricing
NM_008362 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038965 predicted 1223
2 SASI_Hs01_00038966 predicted 811
3 SASI_Hs01_00038967 predicted 1035
4 SASI_Hs01_00038969 predicted 964
5 SASI_Hs01_00038971 predicted 339
6 SASI_Hs02_00303414 predicted 676
7 SASI_Hs01_00038972 predicted 262
8 SASI_Hs01_00038973 predicted 755
9 SASI_Hs01_00038974 predicted 656
10 SASI_Hs02_00303415 predicted 488
11 SASI_Hs01_00038968 predicted 1585
12 SASI_Hs01_00038970 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013123 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00036356 predicted 727
2 SASI_Rn01_00036357 predicted 203
3 SASI_Rn01_00036358 predicted 267
4 SASI_Rn02_00260903 predicted 1192
5 SASI_Rn01_00036360 predicted 927
6 SASI_Rn01_00036361 predicted 656
7 SASI_Rn01_00036362 predicted 1348
8 SASI_Rn01_00036363 predicted 684
9 SASI_Rn01_00036365 predicted 783
10 SASI_Rn02_00260904 predicted 1292
11 SASI_Rn01_00036359 predicted 497
12 SASI_Rn01_00036364 predicted 448
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001123382 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00309865 predicted 1017
2 SASI_Mm02_00309866 predicted 514
3 SASI_Mm02_00309867 predicted 1446
4 SASI_Mm02_00309868 predicted 1129
5 SASI_Mm02_00309869 predicted 1459
6 SASI_Mm02_00309870 predicted 907
7 SASI_Mm02_00309871 predicted 593
8 SASI_Mm02_00309872 predicted 1803
9 SASI_Mm02_00309873 predicted 930
10 SASI_Mm02_00309874 predicted 1032
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008362 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00144254 predicted 947
2 SASI_Mm02_00313717 predicted 448
3 SASI_Mm01_00144256 predicted 1378
4 SASI_Mm01_00144257 predicted 1063
5 SASI_Mm01_00144258 predicted 1385
6 SASI_Mm01_00144259 predicted 846
7 SASI_Mm01_00144260 predicted 522
8 SASI_Mm01_00144261 predicted 1735
9 SASI_Mm02_00313718 predicted 864
10 SASI_Mm01_00144262 predicted 963
11 SASI_Mm01_00144255 predicted 866
12 SASI_Mm01_00144263 predicted 815
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000877
VALIDATED
IL1R1 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor, type I
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000877.2-4473s1c1
Sequence:CCGGCCCGTGAACTTCCTTTGACTTCTCGAGAAGTCAAAGGAAGTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-1511s1c1
Sequence:CCGGGCTCTTGTTCAGGATGGAATTCTCGAGAATTCCATCCTGAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-1022s1c1
Sequence:CCGGGCCAAGAATACACATGGTATACTCGAGTATACCATGTGTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000877.2-458s1c1
Sequence:CCGGGCCATATTTAAGCAGAAACTACTCGAGTAGTTTCTGCTTAAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-711s1c1
Sequence:CCGGCCCGGGTAATAGAATTTATTACTCGAGTAATAAATTCTATTACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-348s21c1
Sequence:CCGGAGGATTCAGGACATTACTATTCTCGAGAATAGTAATGTCCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-965s21c1
Sequence:CCGGGTGCTTAATATATCGGAAATTCTCGAGAATTTCCGATATATTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-1036s21c1
Sequence:CCGGTGGTATAGATGCAGCATATATCTCGAGATATATGCTGCATCTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000360073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-447s21c1
Sequence:CCGGATAATGCACAAGCCATATTTACTCGAGTAAATATGGCTTGTGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000877
VALIDATED
IL1R1 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor, type I
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000877.2-4473s1c1
Sequence:CCGGCCCGTGAACTTCCTTTGACTTCTCGAGAAGTCAAAGGAAGTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-1511s1c1
Sequence:CCGGGCTCTTGTTCAGGATGGAATTCTCGAGAATTCCATCCTGAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-1022s1c1
Sequence:CCGGGCCAAGAATACACATGGTATACTCGAGTATACCATGTGTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000877.2-458s1c1
Sequence:CCGGGCCATATTTAAGCAGAAACTACTCGAGTAGTTTCTGCTTAAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-711s1c1
Sequence:CCGGCCCGGGTAATAGAATTTATTACTCGAGTAATAAATTCTATTACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-348s21c1
Sequence:CCGGAGGATTCAGGACATTACTATTCTCGAGAATAGTAATGTCCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-965s21c1
Sequence:CCGGGTGCTTAATATATCGGAAATTCTCGAGAATTTCCGATATATTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-1036s21c1
Sequence:CCGGTGGTATAGATGCAGCATATATCTCGAGATATATGCTGCATCTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000360073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-447s21c1
Sequence:CCGGATAATGCACAAGCCATATTTACTCGAGTAAATATGGCTTGTGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000877
VALIDATED
IL1R1 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor, type I
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059258    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000877.2-4473s1c1
Sequence:CCGGCCCGTGAACTTCCTTTGACTTCTCGAGAAGTCAAAGGAAGTTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059261    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-1511s1c1
Sequence:CCGGGCTCTTGTTCAGGATGGAATTCTCGAGAATTCCATCCTGAACAAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059260    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-1022s1c1
Sequence:CCGGGCCAAGAATACACATGGTATACTCGAGTATACCATGTGTATTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000877.2-458s1c1
Sequence:CCGGGCCATATTTAAGCAGAAACTACTCGAGTAGTTTCTGCTTAAATATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059262    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 1 Clone ID:NM_000877.2-711s1c1
Sequence:CCGGCCCGGGTAATAGAATTTATTACTCGAGTAATAAATTCTATTACCCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360113    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-348s21c1
Sequence:CCGGAGGATTCAGGACATTACTATTCTCGAGAATAGTAATGTCCTGAATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360114    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-965s21c1
Sequence:CCGGGTGCTTAATATATCGGAAATTCTCGAGAATTTCCGATATATTAAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360115    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-1036s21c1
Sequence:CCGGTGGTATAGATGCAGCATATATCTCGAGATATATGCTGCATCTATACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000360073    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000877.2-447s21c1
Sequence:CCGGATAATGCACAAGCCATATTTACTCGAGTAAATATGGCTTGTGCATTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008362
VALIDATED
IL1R1 MISSION shRNA Bacterial Glycerol Stock
interleukin 1 receptor, type I
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000012338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008362.1-4398s1c1
Sequence:CCGGCCGTACTTTCTGATGGTGTTTCTCGAGAAACACCATCAGAAAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-746s1c1
Sequence:CCGGCGTGAGCTTCTTCGGAGTAAACTCGAGTTTACTCCGAAGAAGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008362.1-1866s1c1
Sequence:CCGGCCATTGTCTAAACACCGCTTACTCGAGTAAGCGGTGTTTAGACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-389s1c1
Sequence:CCGGCGACACCATAATTTGGTACAACTCGAGTTGTACCAAATTATGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000012339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-1731s1c1
Sequence:CCGGCCAGATTCTATTCAGTTCATTCTCGAGAATGAACTGAATAGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008362.2-4397s21c1
Sequence:CCGGCCGTACTTTCTGATGGTGTTTCTCGAGAAACACCATCAGAAAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-1731s21c1
Sequence:CCGGCCAGATTCTATTCAGTTCATTCTCGAGAATGAACTGAATAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000344988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-389s21c1
Sequence:CCGGCGACACCATAATTTGGTACAACTCGAGTTGTACCAAATTATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000345063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-1866s21c1
Sequence:CCGGCCATTGTCTAAACACCGCTTACTCGAGTAAGCGGTGTTTAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008362
VALIDATED
IL1R1 MISSION shRNA shRNA Plasmid DNA
interleukin 1 receptor, type I
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000012338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008362.1-4398s1c1
Sequence:CCGGCCGTACTTTCTGATGGTGTTTCTCGAGAAACACCATCAGAAAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-746s1c1
Sequence:CCGGCGTGAGCTTCTTCGGAGTAAACTCGAGTTTACTCCGAAGAAGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008362.1-1866s1c1
Sequence:CCGGCCATTGTCTAAACACCGCTTACTCGAGTAAGCGGTGTTTAGACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-389s1c1
Sequence:CCGGCGACACCATAATTTGGTACAACTCGAGTTGTACCAAATTATGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000012339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-1731s1c1
Sequence:CCGGCCAGATTCTATTCAGTTCATTCTCGAGAATGAACTGAATAGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008362.2-4397s21c1
Sequence:CCGGCCGTACTTTCTGATGGTGTTTCTCGAGAAACACCATCAGAAAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-1731s21c1
Sequence:CCGGCCAGATTCTATTCAGTTCATTCTCGAGAATGAACTGAATAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000344988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-389s21c1
Sequence:CCGGCGACACCATAATTTGGTACAACTCGAGTTGTACCAAATTATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000345063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-1866s21c1
Sequence:CCGGCCATTGTCTAAACACCGCTTACTCGAGTAAGCGGTGTTTAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008362
VALIDATED
IL1R1 MISSION shRNA Lentiviral Transduction Particles
interleukin 1 receptor, type I
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000012338    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008362.1-4398s1c1
Sequence:CCGGCCGTACTTTCTGATGGTGTTTCTCGAGAAACACCATCAGAAAGTACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-746s1c1
Sequence:CCGGCGTGAGCTTCTTCGGAGTAAACTCGAGTTTACTCCGAAGAAGCTCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_008362.1-1866s1c1
Sequence:CCGGCCATTGTCTAAACACCGCTTACTCGAGTAAGCGGTGTTTAGACAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-389s1c1
Sequence:CCGGCGACACCATAATTTGGTACAACTCGAGTTGTACCAAATTATGGTGTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000012339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008362.1-1731s1c1
Sequence:CCGGCCAGATTCTATTCAGTTCATTCTCGAGAATGAACTGAATAGAATCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_008362.2-4397s21c1
Sequence:CCGGCCGTACTTTCTGATGGTGTTTCTCGAGAAACACCATCAGAAAGTACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-1731s21c1
Sequence:CCGGCCAGATTCTATTCAGTTCATTCTCGAGAATGAACTGAATAGAATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000344988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-389s21c1
Sequence:CCGGCGACACCATAATTTGGTACAACTCGAGTTGTACCAAATTATGGTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000345063    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_008362.2-1866s21c1
Sequence:CCGGCCATTGTCTAAACACCGCTTACTCGAGTAAGCGGTGTTTAGACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks