EMAIL THIS PAGE TO A FRIEND

IL20

interleukin 20

Synonyms: IL-20 IL10D ZCYTO10
UniProtKB ID: Q9NYY1, Q17RB3, Q96QZ6
Gene ID:
Human(50604) Summary: The protein encoded by this gene is a cytokine structurally related to interleukin 10 (IL10). This cytokine has been shown to transduce its signal through signal transducer and activator of transcription 3 (STAT3) in keratinocytes. A specific receptor for this cytokine is found to be expressed in skin and upregulated dramatically in psoriatic skin, suggesting a role for this protein in epidermal function and psoriasis. [provided by RefSeq, Jul 2008]
Mouse(58181) interleukin 20
Rat(681112) interleukin 20
naked mole-rat(101707909) interleukin 20
sheep(101112916) interleukin 20
dog(609203) interleukin 20
domestic cat(101096130) interleukin 20
cow(515533) interleukin 20
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021380 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021380 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021380 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018724 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018724 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018724 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU001741 MISSION® esiRNA esiRNA targeting human IL20 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018724 Rosetta Predictions human pricing
XM_001060362 Rosetta Predictions rat pricing
NM_021380 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00069824 predicted 381
2 SASI_Hs01_00069825 predicted 411
3 SASI_Hs01_00069826 predicted 291
4 SASI_Hs01_00069827 predicted 304
5 SASI_Hs01_00069829 predicted 501
6 SASI_Hs01_00069830 predicted 288
7 SASI_Hs01_00069831 predicted 302
8 SASI_Hs02_00352267 predicted 464
9 SASI_Hs01_00069832 predicted 217
10 SASI_Hs01_00069833 predicted 299
11 SASI_Hs01_00069828 predicted 563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001060362 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00296196 predicted 232
2 SASI_Rn02_00296197 predicted 234
3 SASI_Rn02_00296198 predicted 240
4 SASI_Rn02_00296199 predicted 196
5 SASI_Rn02_00296200 predicted 200
6 SASI_Rn02_00296201 predicted 212
7 SASI_Rn02_00296202 predicted 207
8 SASI_Rn02_00296203 predicted 241
9 SASI_Rn02_00296204 predicted 199
10 SASI_Rn02_00296205 predicted 235
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021380 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00190729 predicted 578
2 SASI_Mm01_00190730 predicted 319
3 SASI_Mm01_00190731 predicted 576
4 SASI_Mm01_00190732 predicted 226
5 SASI_Mm01_00190733 predicted 429
6 SASI_Mm01_00190734 predicted 219
7 SASI_Mm01_00190735 predicted 430
8 SASI_Mm01_00190736 predicted 226
9 SASI_Mm02_00325971 predicted 374
10 SASI_Mm01_00190737 predicted 441
11 SASI_Mm01_00190738 predicted 587
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021380
IL20 MISSION shRNA Bacterial Glycerol Stock
interleukin 20
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-582s21c1
Sequence:CCGGGGATGGAGGAGATGCTATAGACTCGAGTCTATAGCATCTCCTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-275s21c1
Sequence:CCGGGAGTCTTTGAAAGACATAAAGCTCGAGCTTTATGTCTTTCAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-230s21c1
Sequence:CCGGCAAGCTGAAGATACAAATATTCTCGAGAATATTTGTATCTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-179s1c1
Sequence:CCGGGCAAACCTACAGGCAATACAACTCGAGTTGTATTGCCTGTAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-499s1c1
Sequence:CCGGCCAAATTCTGAGTCACTTCATCTCGAGATGAAGTGACTCAGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021380.1-623s1c1
Sequence:CCGGAGAACACTCCTGTCCAAGAATCTCGAGATTCTTGGACAGGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-320s1c1
Sequence:CCGGCGTCATCTAGTGAGATTCTATCTCGAGATAGAATCTCACTAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-551s1c1
Sequence:CCGGGCTTTGGGAGAACTAGGCATTCTCGAGAATGCCTAGTTCTCCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021380
IL20 MISSION shRNA shRNA Plasmid DNA
interleukin 20
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-582s21c1
Sequence:CCGGGGATGGAGGAGATGCTATAGACTCGAGTCTATAGCATCTCCTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-275s21c1
Sequence:CCGGGAGTCTTTGAAAGACATAAAGCTCGAGCTTTATGTCTTTCAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-230s21c1
Sequence:CCGGCAAGCTGAAGATACAAATATTCTCGAGAATATTTGTATCTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-179s1c1
Sequence:CCGGGCAAACCTACAGGCAATACAACTCGAGTTGTATTGCCTGTAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-499s1c1
Sequence:CCGGCCAAATTCTGAGTCACTTCATCTCGAGATGAAGTGACTCAGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021380.1-623s1c1
Sequence:CCGGAGAACACTCCTGTCCAAGAATCTCGAGATTCTTGGACAGGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-320s1c1
Sequence:CCGGCGTCATCTAGTGAGATTCTATCTCGAGATAGAATCTCACTAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-551s1c1
Sequence:CCGGGCTTTGGGAGAACTAGGCATTCTCGAGAATGCCTAGTTCTCCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021380
IL20 MISSION shRNA Lentiviral Transduction Particles
interleukin 20
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-582s21c1
Sequence:CCGGGGATGGAGGAGATGCTATAGACTCGAGTCTATAGCATCTCCTCCATCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419450    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-275s21c1
Sequence:CCGGGAGTCTTTGAAAGACATAAAGCTCGAGCTTTATGTCTTTCAAAGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432369    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021380.1-230s21c1
Sequence:CCGGCAAGCTGAAGATACAAATATTCTCGAGAATATTTGTATCTTCAGCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067340    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-179s1c1
Sequence:CCGGGCAAACCTACAGGCAATACAACTCGAGTTGTATTGCCTGTAGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067341    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-499s1c1
Sequence:CCGGCCAAATTCTGAGTCACTTCATCTCGAGATGAAGTGACTCAGAATTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067338    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021380.1-623s1c1
Sequence:CCGGAGAACACTCCTGTCCAAGAATCTCGAGATTCTTGGACAGGAGTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067339    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-320s1c1
Sequence:CCGGCGTCATCTAGTGAGATTCTATCTCGAGATAGAATCTCACTAGATGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067342    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021380.1-551s1c1
Sequence:CCGGGCTTTGGGAGAACTAGGCATTCTCGAGAATGCCTAGTTCTCCCAAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018724
IL20 MISSION shRNA Bacterial Glycerol Stock
interleukin 20
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018724.3-1030s21c1
Sequence:CCGGCTGATGCTCTGTGAGATATTTCTCGAGAAATATCTCACAGAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000378741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018724.3-114s21c1
Sequence:CCGGGGACTGAAGACACTCAATTTGCTCGAGCAAATTGAGTGTCTTCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018724.3-689s21c1
Sequence:CCGGTGGTCACAGTGTATCTTATTTCTCGAGAAATAAGATACACTGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-150s1c1
Sequence:CCGGGCCACAAACCTTCAGGAAATACTCGAGTATTTCCTGAAGGTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-294s1c1
Sequence:CCGGCGCCATTTGCTAAGACTCTATCTCGAGATAGAGTCTTAGCAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018724.3-751s1c1
Sequence:CCGGCCAATCTTAATTGAGACCATACTCGAGTATGGTCTCAATTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-376s1c1
Sequence:CCGGGCCTCGCCAATTCCTTTCTTACTCGAGTAAGAAAGGAATTGGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-204s1c1
Sequence:CCGGCAAGCCAAAGATGGAAACATTCTCGAGAATGTTTCCATCTTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018724
IL20 MISSION shRNA shRNA Plasmid DNA
interleukin 20
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018724.3-1030s21c1
Sequence:CCGGCTGATGCTCTGTGAGATATTTCTCGAGAAATATCTCACAGAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000378741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018724.3-114s21c1
Sequence:CCGGGGACTGAAGACACTCAATTTGCTCGAGCAAATTGAGTGTCTTCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018724.3-689s21c1
Sequence:CCGGTGGTCACAGTGTATCTTATTTCTCGAGAAATAAGATACACTGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-150s1c1
Sequence:CCGGGCCACAAACCTTCAGGAAATACTCGAGTATTTCCTGAAGGTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-294s1c1
Sequence:CCGGCGCCATTTGCTAAGACTCTATCTCGAGATAGAGTCTTAGCAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018724.3-751s1c1
Sequence:CCGGCCAATCTTAATTGAGACCATACTCGAGTATGGTCTCAATTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-376s1c1
Sequence:CCGGGCCTCGCCAATTCCTTTCTTACTCGAGTAAGAAAGGAATTGGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-204s1c1
Sequence:CCGGCAAGCCAAAGATGGAAACATTCTCGAGAATGTTTCCATCTTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018724
IL20 MISSION shRNA Lentiviral Transduction Particles
interleukin 20
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372634    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018724.3-1030s21c1
Sequence:CCGGCTGATGCTCTGTGAGATATTTCTCGAGAAATATCTCACAGAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000378741    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018724.3-114s21c1
Sequence:CCGGGGACTGAAGACACTCAATTTGCTCGAGCAAATTGAGTGTCTTCAGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372578    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_018724.3-689s21c1
Sequence:CCGGTGGTCACAGTGTATCTTATTTCTCGAGAAATAAGATACACTGTGACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-150s1c1
Sequence:CCGGGCCACAAACCTTCAGGAAATACTCGAGTATTTCCTGAAGGTTTGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-294s1c1
Sequence:CCGGCGCCATTTGCTAAGACTCTATCTCGAGATAGAGTCTTAGCAAATGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058213    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_018724.3-751s1c1
Sequence:CCGGCCAATCTTAATTGAGACCATACTCGAGTATGGTCTCAATTAAGATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-376s1c1
Sequence:CCGGGCCTCGCCAATTCCTTTCTTACTCGAGTAAGAAAGGAATTGGCGAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018724.3-204s1c1
Sequence:CCGGCAAGCCAAAGATGGAAACATTCTCGAGAATGTTTCCATCTTTGGCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks