EMAIL THIS PAGE TO A FRIEND

IL22RA1

interleukin 22 receptor, alpha 1

Synonyms: CRF2-9 IL22R IL22R1
UniProtKB ID: Q8N6P7, A8K839, B2R9Y9, Q9HB22
Gene ID:
Human(58985) Summary: The protein encoded by this gene belongs to the class II cytokine receptor family, and has been shown to be a receptor for interleukin 22 (IL22). IL22 receptor is a protein complex that consists of this protein and interleukin 10 receptor, beta (IL10BR/CRFB4), a subunit also shared by the receptor complex for interleukin 10 (IL10). This gene and interleukin 28 receptor, alpha (IL28RA) form a cytokine receptor gene cluster in the chromosomal region 1p36. [provided by RefSeq, Jul 2008]
Mouse(230828) interleukin 22 receptor, alpha 1
Rat(362629) interleukin 22 receptor, alpha 1
domestic guinea pig(100720709) interleukin 22 receptor, alpha 1
naked mole-rat(101721365) interleukin 22 receptor, alpha 1
sheep(101118168) interleukin 22 receptor, alpha 1
Domestic Rabbit(100344077) interleukin 22 receptor, alpha 1
chicken(419692) interleukin 22 receptor, alpha 1
cow(508044) interleukin 22 receptor, alpha 1
Horse(100071510) interleukin 22 receptor, alpha 1
domestic cat(101100741) interleukin 22 receptor, alpha 1
dog(612279) interleukin 22 receptor, alpha 1
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021258 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021258 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021258 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178257 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178257 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178257 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU030581 MISSION® esiRNA esiRNA human IL22RA1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021258 Rosetta Predictions human pricing
XM_001069458 Rosetta Predictions rat pricing
XM_342947 Rosetta Predictions rat pricing
NM_178257 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021258 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092607 predicted 1249
2 SASI_Hs01_00092608 predicted 402
3 SASI_Hs01_00092609 predicted 430
4 SASI_Hs02_00354918 predicted 846
5 SASI_Hs01_00092610 predicted 1354
6 SASI_Hs01_00092611 predicted 1298
7 SASI_Hs01_00092612 predicted 429
8 SASI_Hs01_00092613 predicted 1937
9 SASI_Hs01_00092616 predicted 1502
10 SASI_Hs02_00354919 predicted 1314
11 SASI_Hs01_00092614 predicted 1320
12 SASI_Hs01_00092615 predicted 1017
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069458 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00328157 predicted 213
2 SASI_Rn02_00328158 predicted 285
3 SASI_Rn02_00328159 predicted 1734
4 SASI_Rn02_00328160 predicted 838
5 SASI_Rn02_00328161 predicted 588
6 SASI_Rn02_00328162 predicted 1581
7 SASI_Rn02_00328163 predicted 672
8 SASI_Rn02_00328164 predicted 1854
9 SASI_Rn02_00328165 predicted 1485
10 SASI_Rn02_00328166 predicted 1072
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_342947 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395101 predicted 604
2 SASI_Rn02_00395102 predicted 584
3 SASI_Rn02_00395103 predicted 540
4 SASI_Rn02_00395104 predicted 1024
5 SASI_Rn02_00395105 predicted 318
6 SASI_Rn02_00395106 predicted 843
7 SASI_Rn02_00395107 predicted 568
8 SASI_Rn02_00395108 predicted 1120
9 SASI_Rn02_00395109 predicted 586
10 SASI_Rn02_00395110 predicted 671
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178257 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00042095 predicted 1165
2 SASI_Mm01_00042096 predicted 613
3 SASI_Mm01_00042097 predicted 225
4 SASI_Mm01_00042098 predicted 969
5 SASI_Mm01_00042099 predicted 734
6 SASI_Mm01_00042100 predicted 1008
7 SASI_Mm01_00042101 predicted 310
8 SASI_Mm02_00348669 predicted 979
9 SASI_Mm01_00042102 predicted 1165
10 SASI_Mm01_00042103 predicted 775
11 SASI_Mm01_00042104 predicted 650
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021258
IL22RA1 MISSION shRNA Bacterial Glycerol Stock
interleukin 22 receptor, alpha 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000422467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021258.2-1289s21c1
Sequence:CCGGGGACACTTTCTAGTCCTAAACCTCGAGGTTTAGGACTAGAAAGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021258.2-1497s21c1
Sequence:CCGGAGGGACACCACAGTACCTAAACTCGAGTTTAGGTACTGTGGTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-585s1c1
Sequence:CCGGGCAGAGAGAATATGAGTTCTTCTCGAGAAGAACTCATATTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-120s1c1
Sequence:CCGGCGTGAAATTCCAGTCCAGCAACTCGAGTTGCTGGACTGGAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1318s1c1
Sequence:CCGGCCTAAAGGTCAGCTTCAGAAACTCGAGTTTCTGAAGCTGACCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1000s1c1
Sequence:CCGGCTGTCCGAGATCACCTACTTACTCGAGTAAGTAGGTGATCTCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1149s1c1
Sequence:CCGGCGAAGCTCAATTCCCATTCTACTCGAGTAGAATGGGAATTGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021258
IL22RA1 MISSION shRNA shRNA Plasmid DNA
interleukin 22 receptor, alpha 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000422467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021258.2-1289s21c1
Sequence:CCGGGGACACTTTCTAGTCCTAAACCTCGAGGTTTAGGACTAGAAAGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021258.2-1497s21c1
Sequence:CCGGAGGGACACCACAGTACCTAAACTCGAGTTTAGGTACTGTGGTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-585s1c1
Sequence:CCGGGCAGAGAGAATATGAGTTCTTCTCGAGAAGAACTCATATTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-120s1c1
Sequence:CCGGCGTGAAATTCCAGTCCAGCAACTCGAGTTGCTGGACTGGAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1318s1c1
Sequence:CCGGCCTAAAGGTCAGCTTCAGAAACTCGAGTTTCTGAAGCTGACCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1000s1c1
Sequence:CCGGCTGTCCGAGATCACCTACTTACTCGAGTAAGTAGGTGATCTCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1149s1c1
Sequence:CCGGCGAAGCTCAATTCCCATTCTACTCGAGTAGAATGGGAATTGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021258
IL22RA1 MISSION shRNA Lentiviral Transduction Particles
interleukin 22 receptor, alpha 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000422467    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021258.2-1289s21c1
Sequence:CCGGGGACACTTTCTAGTCCTAAACCTCGAGGTTTAGGACTAGAAAGTGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419356    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021258.2-1497s21c1
Sequence:CCGGAGGGACACCACAGTACCTAAACTCGAGTTTAGGTACTGTGGTGTCCCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-585s1c1
Sequence:CCGGGCAGAGAGAATATGAGTTCTTCTCGAGAAGAACTCATATTCTCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-120s1c1
Sequence:CCGGCGTGAAATTCCAGTCCAGCAACTCGAGTTGCTGGACTGGAATTTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1318s1c1
Sequence:CCGGCCTAAAGGTCAGCTTCAGAAACTCGAGTTTCTGAAGCTGACCTTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1000s1c1
Sequence:CCGGCTGTCCGAGATCACCTACTTACTCGAGTAAGTAGGTGATCTCGGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021258.2-1149s1c1
Sequence:CCGGCGAAGCTCAATTCCCATTCTACTCGAGTAGAATGGGAATTGAGCTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178257
IL22RA1 MISSION shRNA Bacterial Glycerol Stock
interleukin 22 receptor, alpha 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-313s1c1
Sequence:CCGGCCAGTCACAAAGATGACTGATCTCGAGATCAGTCATCTTTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-1529s1c1
Sequence:CCGGCCCTCCCTTTGCACGTCCATTCTCGAGAATGGACGTGCAAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-614s1c1
Sequence:CCGGCTCCGATATTGTCCAAGGAAACTCGAGTTTCCTTGGACAATATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-1120s1c1
Sequence:CCGGGCTCTGTTCTACTCACCACAACTCGAGTTGTGGTGAGTAGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-152s1c1
Sequence:CCGGCCGTCTACAGTGTGGAATATACTCGAGTATATTCCACACTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178257
IL22RA1 MISSION shRNA shRNA Plasmid DNA
interleukin 22 receptor, alpha 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-313s1c1
Sequence:CCGGCCAGTCACAAAGATGACTGATCTCGAGATCAGTCATCTTTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-1529s1c1
Sequence:CCGGCCCTCCCTTTGCACGTCCATTCTCGAGAATGGACGTGCAAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-614s1c1
Sequence:CCGGCTCCGATATTGTCCAAGGAAACTCGAGTTTCCTTGGACAATATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-1120s1c1
Sequence:CCGGGCTCTGTTCTACTCACCACAACTCGAGTTGTGGTGAGTAGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-152s1c1
Sequence:CCGGCCGTCTACAGTGTGGAATATACTCGAGTATATTCCACACTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178257
IL22RA1 MISSION shRNA Lentiviral Transduction Particles
interleukin 22 receptor, alpha 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065865    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-313s1c1
Sequence:CCGGCCAGTCACAAAGATGACTGATCTCGAGATCAGTCATCTTTGTGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-1529s1c1
Sequence:CCGGCCCTCCCTTTGCACGTCCATTCTCGAGAATGGACGTGCAAAGGGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065867    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-614s1c1
Sequence:CCGGCTCCGATATTGTCCAAGGAAACTCGAGTTTCCTTGGACAATATCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065863    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-1120s1c1
Sequence:CCGGGCTCTGTTCTACTCACCACAACTCGAGTTGTGGTGAGTAGAACAGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065864    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178257.1-152s1c1
Sequence:CCGGCCGTCTACAGTGTGGAATATACTCGAGTATATTCCACACTGTAGACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks