EMAIL THIS PAGE TO A FRIEND

IL22RA2

interleukin 22 receptor, alpha 2

Synonyms: CRF2-10 CRF2-S1 CRF2X IL-22BP IL-22R-alpha-2 IL-22RA2 ZCYTOR16
UniProtKB ID: Q969J5, Q08AH7, Q6UWM1, Q96A41, Q96QR0
Gene ID:
Human(116379) Summary: This gene encodes a member of the class II cytokine receptor family. The encoded soluble protein specifically binds to and inhibits interleukin 22 activity by blocking the interaction of interleukin 22 with its cell surface receptor. The encoded protein may be important in the regulation of inflammatory response, and has been implicated in the regulation of tumorigenesis in the colon. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2013]
Mouse(237310) interleukin 22 receptor, alpha 2
Rat(444986) interleukin 22 receptor, alpha 2
chicken(770428) interleukin 22 receptor, alpha 2
cow(533061) interleukin 22 receptor, alpha 2
domestic cat(101083429) interleukin 22 receptor, alpha 2
dog(611470) interleukin 22 receptor, alpha 2
sheep(101121781) interleukin 22 receptor, alpha 2
domestic guinea pig(100723811) interleukin 22 receptor, alpha 2
naked mole-rat(101698371) interleukin 22 receptor, alpha 2
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1522 Human IL-22BP ELISA human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_052962 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_052962 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_052962 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_178258 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178258 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178258 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_052962 Rosetta Predictions human pricing
NM_181309 Rosetta Predictions human pricing
NM_181310 Rosetta Predictions human pricing
NM_001003404 Rosetta Predictions rat pricing
NM_178258 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052962 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00132739 predicted 1150
2 SASI_Hs01_00132740 predicted 1151
3 SASI_Hs01_00132741 predicted 1330
4 SASI_Hs02_00361765 predicted 1353
5 SASI_Hs02_00361766 predicted 1223
6 SASI_Hs01_00132742 predicted 871
7 SASI_Hs01_00132743 predicted 671
8 SASI_Hs01_00132745 predicted 779
9 SASI_Hs01_00132746 predicted 643
10 SASI_Hs01_00132748 predicted 452
11 SASI_Hs01_00132744 predicted 820
12 SASI_Hs01_00132747 predicted 991
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181309 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147172 predicted 1054
2 SASI_Hs01_00147173 predicted 1049
3 SASI_Hs01_00147174 predicted 1232
4 SASI_Hs02_00369980 predicted 1261
5 SASI_Hs02_00369981 predicted 1131
6 SASI_Hs01_00147175 predicted 778
7 SASI_Hs01_00147176 predicted 580
8 SASI_Hs01_00147178 predicted 685
9 SASI_Hs01_00147179 predicted 545
10 SASI_Hs01_00147181 predicted 454
11 SASI_Hs01_00147177 predicted 725
12 SASI_Hs01_00147180 predicted 898
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181310 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00095524 predicted 884
2 SASI_Hs01_00095525 predicted 883
3 SASI_Hs01_00095526 predicted 1064
4 SASI_Hs02_00369982 predicted 1094
5 SASI_Hs02_00369983 predicted 956
6 SASI_Hs01_00095527 predicted 572
7 SASI_Hs01_00095528 predicted 839
8 SASI_Hs01_00095529 predicted 541
9 SASI_Hs01_00095531 predicted 452
10 SASI_Hs01_00095532 predicted 802
11 SASI_Hs01_00095530 predicted 724
12 SASI_Hs01_00095533 predicted 305
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003404 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00096129 predicted 422
2 SASI_Rn01_00096130 predicted 430
3 SASI_Rn01_00096131 predicted 131
4 SASI_Rn01_00096132 predicted 312
5 SASI_Rn01_00096133 predicted 479
6 SASI_Rn01_00096134 predicted 693
7 SASI_Rn02_00198038 predicted 121
8 SASI_Rn01_00096135 predicted 761
9 SASI_Rn01_00096136 predicted 582
10 SASI_Rn01_00096137 predicted 598
11 SASI_Rn01_00096138 predicted 543
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178258 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00348670 predicted 920
2 SASI_Mm02_00348671 predicted 497
3 SASI_Mm01_00037817 predicted 584
4 SASI_Mm02_00348672 predicted 749
5 SASI_Mm02_00348673 predicted 910
6 SASI_Mm01_00037819 predicted 267
7 SASI_Mm01_00037821 predicted 570
8 SASI_Mm02_00348674 predicted 399
9 SASI_Mm02_00348675 predicted 794
10 SASI_Mm02_00348676 predicted 677
11 SASI_Mm01_00037812 predicted 695
12 SASI_Mm01_00037813 predicted 577
13 SASI_Mm01_00037814 predicted 594
14 SASI_Mm01_00037815 predicted 507
15 SASI_Mm01_00037816 predicted 750
16 SASI_Mm01_00037818 predicted 826
17 SASI_Mm01_00037820 predicted 393
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_052962
IL22RA2 MISSION shRNA Bacterial Glycerol Stock
interleukin 22 receptor, alpha 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000058463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-1008s1c1
Sequence:CCGGGCTACTGTGTAGTGGCTGAAACTCGAGTTTCAGCCACTACACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-590s1c1
Sequence:CCGGGCTAAATATGGACAGAGACAACTCGAGTTGTCTCTGTCCATATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-401s1c1
Sequence:CCGGGTACAATTTCAGTCCCGAAATCTCGAGATTTCGGGACTGAAATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-974s1c1
Sequence:CCGGGCGGTTGAAATTGAAGCTCTACTCGAGTAGAGCTTCAATTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-793s1c1
Sequence:CCGGCATGAATATAACCCAAGTCAACTCGAGTTGACTTGGGTTATATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052962.2-676s21c1
Sequence:CCGGAGACATACAGGAACCTTATTACTCGAGTAATAAGGTTCCTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052962.2-1153s21c1
Sequence:CCGGCTCGTGTTTGAAGGATCTTATCTCGAGATAAGATCCTTCAAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052962.2-838s21c1
Sequence:CCGGTGCTCCAAATTTACCATATAGCTCGAGCTATATGGTAAATTTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_052962
IL22RA2 MISSION shRNA shRNA Plasmid DNA
interleukin 22 receptor, alpha 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000058463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-1008s1c1
Sequence:CCGGGCTACTGTGTAGTGGCTGAAACTCGAGTTTCAGCCACTACACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-590s1c1
Sequence:CCGGGCTAAATATGGACAGAGACAACTCGAGTTGTCTCTGTCCATATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-401s1c1
Sequence:CCGGGTACAATTTCAGTCCCGAAATCTCGAGATTTCGGGACTGAAATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-974s1c1
Sequence:CCGGGCGGTTGAAATTGAAGCTCTACTCGAGTAGAGCTTCAATTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-793s1c1
Sequence:CCGGCATGAATATAACCCAAGTCAACTCGAGTTGACTTGGGTTATATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052962.2-676s21c1
Sequence:CCGGAGACATACAGGAACCTTATTACTCGAGTAATAAGGTTCCTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052962.2-1153s21c1
Sequence:CCGGCTCGTGTTTGAAGGATCTTATCTCGAGATAAGATCCTTCAAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052962.2-838s21c1
Sequence:CCGGTGCTCCAAATTTACCATATAGCTCGAGCTATATGGTAAATTTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_052962
IL22RA2 MISSION shRNA Lentiviral Transduction Particles
interleukin 22 receptor, alpha 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000058463    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-1008s1c1
Sequence:CCGGGCTACTGTGTAGTGGCTGAAACTCGAGTTTCAGCCACTACACAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058467    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-590s1c1
Sequence:CCGGGCTAAATATGGACAGAGACAACTCGAGTTGTCTCTGTCCATATTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058464    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-401s1c1
Sequence:CCGGGTACAATTTCAGTCCCGAAATCTCGAGATTTCGGGACTGAAATTGTACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058465    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-974s1c1
Sequence:CCGGGCGGTTGAAATTGAAGCTCTACTCGAGTAGAGCTTCAATTTCAACCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058466    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_052962.2-793s1c1
Sequence:CCGGCATGAATATAACCCAAGTCAACTCGAGTTGACTTGGGTTATATTCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372639    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052962.2-676s21c1
Sequence:CCGGAGACATACAGGAACCTTATTACTCGAGTAATAAGGTTCCTGTATGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372640    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_052962.2-1153s21c1
Sequence:CCGGCTCGTGTTTGAAGGATCTTATCTCGAGATAAGATCCTTCAAACACGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372581    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_052962.2-838s21c1
Sequence:CCGGTGCTCCAAATTTACCATATAGCTCGAGCTATATGGTAAATTTGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178258
IL22RA2 MISSION shRNA Bacterial Glycerol Stock
interleukin 22 receptor, alpha 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000065963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178258.3-942s1c1
Sequence:CCGGCCCAGCATTGAAAGGCAGAATCTCGAGATTCTGCCTTTCAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-269s1c1
Sequence:CCGGCCAATGAAACCTTAGACCCATCTCGAGATGGGTCTAAGGTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-493s1c1
Sequence:CCGGGAAACTTACTACGGCTTAGTACTCGAGTACTAAGCCGTAGTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-399s1c1
Sequence:CCGGCGTGACTATAACCCGAGTTAACTCGAGTTAACTCGGGTTATAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-105s1c1
Sequence:CCGGCCGATTTCAGTCCAGAAATTTCTCGAGAAATTTCTGGACTGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178258
IL22RA2 MISSION shRNA shRNA Plasmid DNA
interleukin 22 receptor, alpha 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000065963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178258.3-942s1c1
Sequence:CCGGCCCAGCATTGAAAGGCAGAATCTCGAGATTCTGCCTTTCAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-269s1c1
Sequence:CCGGCCAATGAAACCTTAGACCCATCTCGAGATGGGTCTAAGGTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-493s1c1
Sequence:CCGGGAAACTTACTACGGCTTAGTACTCGAGTACTAAGCCGTAGTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-399s1c1
Sequence:CCGGCGTGACTATAACCCGAGTTAACTCGAGTTAACTCGGGTTATAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-105s1c1
Sequence:CCGGCCGATTTCAGTCCAGAAATTTCTCGAGAAATTTCTGGACTGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178258
IL22RA2 MISSION shRNA Lentiviral Transduction Particles
interleukin 22 receptor, alpha 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000065963    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_178258.3-942s1c1
Sequence:CCGGCCCAGCATTGAAAGGCAGAATCTCGAGATTCTGCCTTTCAATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065967    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-269s1c1
Sequence:CCGGCCAATGAAACCTTAGACCCATCTCGAGATGGGTCTAAGGTTTCATTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065966    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-493s1c1
Sequence:CCGGGAAACTTACTACGGCTTAGTACTCGAGTACTAAGCCGTAGTAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-399s1c1
Sequence:CCGGCGTGACTATAACCCGAGTTAACTCGAGTTAACTCGGGTTATAGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065965    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178258.3-105s1c1
Sequence:CCGGCCGATTTCAGTCCAGAAATTTCTCGAGAAATTTCTGGACTGAAATCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks