EMAIL THIS PAGE TO A FRIEND

IL36A

interleukin 36, alpha

Synonyms: FIL1 FIL1(EPSILON) FIL1E IL-1F6 IL1(EPSILON) IL1F6
UniProtKB ID: Q9UHA7, B2RAD9, Q53SR7, Q5BLR4, Q7RTZ8
Gene ID:
Rat(296541) interleukin 36, alpha
cow(523429) interleukin 36, alpha
sheep(101106251) interleukin 36, alpha
naked mole-rat(101725767) interleukin 36, alpha
38 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0686 Human IL36A / Interleukin-36 Alpha ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014440 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014440 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014440 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014440 Rosetta Predictions human pricing
NM_001106554 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014440 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00222536 predicted 206
2 SASI_Hs01_00222537 predicted 212
3 SASI_Hs01_00222538 predicted 198
4 SASI_Hs01_00222539 predicted 202
5 SASI_Hs01_00222540 predicted 118
6 SASI_Hs01_00222541 predicted 269
7 SASI_Hs01_00222542 predicted 110
8 SASI_Hs01_00222543 predicted 31
9 SASI_Hs01_00222544 predicted 437
10 SASI_Hs01_00222545 predicted 192
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106554 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00220098 predicted 278
2 SASI_Rn02_00220099 predicted 291
3 SASI_Rn02_00220100 predicted 296
4 SASI_Rn02_00220101 predicted 451
5 SASI_Rn02_00220102 predicted 232
6 SASI_Rn02_00220103 predicted 615
7 SASI_Rn02_00220104 predicted 425
8 SASI_Rn02_00220105 predicted 198
9 SASI_Rn02_00220106 predicted 274
10 SASI_Rn02_00220107 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014440
IL36A MISSION shRNA Bacterial Glycerol Stock
interleukin 36, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-185s21c1
Sequence:CCGGCCATCTACCTGGGCCTGAATGCTCGAGCATTCAGGCCCAGGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-38s21c1
Sequence:CCGGGGAGCATTCAGGATATCAATCCTCGAGGATTGATATCCTGAATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-74s21c1
Sequence:CCGGTTCAGGACCAGACGCTCATAGCTCGAGCTATGAGCGTCTGGTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-111s1c1
Sequence:CCGGCCGTATGTCTCCAGTCACTATCTCGAGATAGTGACTGGAGACATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-295s1c1
Sequence:CCGGCCCGAGCCTGTGAAGTCCTTTCTCGAGAAAGGACTTCACAGGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-214s1c1
Sequence:CCGGCTCTGCCTGATGTGTGCTAAACTCGAGTTTAGCACACATCAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-162s1c1
Sequence:CCGGCCTTGAGAAAGACAGAGGGAACTCGAGTTCCCTCTGTCTTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-119s1c1
Sequence:CCGGCTCCAGTCACTATTGCCTTAACTCGAGTTAAGGCAATAGTGACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014440
IL36A MISSION shRNA shRNA Plasmid DNA
interleukin 36, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-185s21c1
Sequence:CCGGCCATCTACCTGGGCCTGAATGCTCGAGCATTCAGGCCCAGGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-38s21c1
Sequence:CCGGGGAGCATTCAGGATATCAATCCTCGAGGATTGATATCCTGAATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-74s21c1
Sequence:CCGGTTCAGGACCAGACGCTCATAGCTCGAGCTATGAGCGTCTGGTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-111s1c1
Sequence:CCGGCCGTATGTCTCCAGTCACTATCTCGAGATAGTGACTGGAGACATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-295s1c1
Sequence:CCGGCCCGAGCCTGTGAAGTCCTTTCTCGAGAAAGGACTTCACAGGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-214s1c1
Sequence:CCGGCTCTGCCTGATGTGTGCTAAACTCGAGTTTAGCACACATCAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-162s1c1
Sequence:CCGGCCTTGAGAAAGACAGAGGGAACTCGAGTTCCCTCTGTCTTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-119s1c1
Sequence:CCGGCTCCAGTCACTATTGCCTTAACTCGAGTTAAGGCAATAGTGACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014440
IL36A MISSION shRNA Lentiviral Transduction Particles
interleukin 36, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372621    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-185s21c1
Sequence:CCGGCCATCTACCTGGGCCTGAATGCTCGAGCATTCAGGCCCAGGTAGATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-38s21c1
Sequence:CCGGGGAGCATTCAGGATATCAATCCTCGAGGATTGATATCCTGAATGCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014440.1-74s21c1
Sequence:CCGGTTCAGGACCAGACGCTCATAGCTCGAGCTATGAGCGTCTGGTCCTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058873    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-111s1c1
Sequence:CCGGCCGTATGTCTCCAGTCACTATCTCGAGATAGTGACTGGAGACATACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058876    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-295s1c1
Sequence:CCGGCCCGAGCCTGTGAAGTCCTTTCTCGAGAAAGGACTTCACAGGCTCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058874    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-214s1c1
Sequence:CCGGCTCTGCCTGATGTGTGCTAAACTCGAGTTTAGCACACATCAGGCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058875    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-162s1c1
Sequence:CCGGCCTTGAGAAAGACAGAGGGAACTCGAGTTCCCTCTGTCTTTCTCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058877    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014440.1-119s1c1
Sequence:CCGGCTCCAGTCACTATTGCCTTAACTCGAGTTAAGGCAATAGTGACTGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks