EMAIL THIS PAGE TO A FRIEND

IL37

interleukin 37

Synonyms: FIL1 FIL1(ZETA) FIL1Z IL-1F7 IL-1H IL-1H4 IL-1RP1 IL-37 IL1F7 IL1H4 IL1RP1
Gene ID:
Human(27178) Summary: The protein encoded by this gene is a member of the interleukin 1 cytokine family. This cytokine can bind to, and may be a ligand for interleukin 18 receptor (IL18R1/IL-1Rrp). This cytokine also binds to interleukin 18 binding protein (IL18BP), an inhibitory binding protein of interleukin 18 (IL18), and subsequently forms a complex with IL18 receptor beta subunit, and through which it inhibits the activity of IL18. This gene along with eight other interleukin 1 family genes form a cytokine gene cluster on chromosome 2. Five alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
cow(786493) interleukin 37
dog(100686057) interleukin 37
naked mole-rat(101724994) interleukin 37
sheep(101111617) interleukin 37
68 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB0687 Human IL1F7 / Interleukin-37 ELISA Kit human pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_173204 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_173204 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_173204 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140841 MISSION® esiRNA esiRNA human IL1F7 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014439 Rosetta Predictions human pricing
NM_173202 Rosetta Predictions human pricing
NM_173203 Rosetta Predictions human pricing
NM_173204 Rosetta Predictions human pricing
NM_173205 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014439 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00128608 predicted 483
2 SASI_Hs01_00128609 predicted 422
3 SASI_Hs01_00128610 predicted 393
4 SASI_Hs01_00128611 predicted 487
5 SASI_Hs01_00128612 predicted 481
6 SASI_Hs01_00128613 predicted 397
7 SASI_Hs01_00128614 predicted 481
8 SASI_Hs01_00128615 predicted 426
9 SASI_Hs01_00128616 predicted 391
10 SASI_Hs01_00128617 predicted 483
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173202 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00024849 predicted 421
2 SASI_Hs01_00024850 predicted 363
3 SASI_Hs01_00024851 predicted 335
4 SASI_Hs01_00024852 predicted 426
5 SASI_Hs01_00024853 predicted 417
6 SASI_Hs01_00024854 predicted 330
7 SASI_Hs01_00024855 predicted 423
8 SASI_Hs01_00024856 predicted 362
9 SASI_Hs01_00024857 predicted 336
10 SASI_Hs01_00024858 predicted 424
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173203 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094089 predicted 300
2 SASI_Hs01_00094090 predicted 243
3 SASI_Hs01_00094091 predicted 209
4 SASI_Hs01_00094092 predicted 307
5 SASI_Hs01_00094093 predicted 302
6 SASI_Hs01_00094094 predicted 209
7 SASI_Hs01_00094095 predicted 303
8 SASI_Hs01_00094096 predicted 243
9 SASI_Hs01_00094097 predicted 210
10 SASI_Hs01_00094098 predicted 299
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173204 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00044824 predicted 361
2 SASI_Hs01_00044825 predicted 304
3 SASI_Hs01_00044826 predicted 273
4 SASI_Hs01_00044827 predicted 229
5 SASI_Hs01_00044828 predicted 307
6 SASI_Hs01_00044829 predicted 401
7 SASI_Hs01_00044830 predicted 366
8 SASI_Hs01_00044831 predicted 366
9 SASI_Hs01_00044832 predicted 400
10 SASI_Hs01_00044833 predicted 312
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_173205 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00190044 predicted 362
2 SASI_Hs01_00190045 predicted 302
3 SASI_Hs01_00190046 predicted 276
4 SASI_Hs01_00190047 predicted 368
5 SASI_Hs01_00190048 predicted 368
6 SASI_Hs01_00190049 predicted 272
7 SASI_Hs01_00190050 predicted 365
8 SASI_Hs01_00190051 predicted 310
9 SASI_Hs01_00190052 predicted 273
10 SASI_Hs01_00190053 predicted 370
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_173204
IL37 MISSION shRNA Bacterial Glycerol Stock
interleukin 37
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-302s21c1
Sequence:CCGGGACAAAGTCATCCATCCCTTCCTCGAGGAAGGGATGGATGACTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-454s21c1
Sequence:CCGGTGCACCTCCTGCAATTGTAATCTCGAGATTACAATTGCAGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-229s21c1
Sequence:CCGGGCGGAGAAAGGAAGTCCGATTCTCGAGAATCGGACTTCCTTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-324s1c1
Sequence:CCGGGCTGAAGAAGGAGAAACTGATCTCGAGATCAGTTTCTCCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-280s1c1
Sequence:CCGGCTCTACTGTGACAAGGATAAACTCGAGTTTATCCTTGTCACAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-195s1c1
Sequence:CCGGCTTTGCATTAGCCTCATCCTTCTCGAGAAGGATGAGGCTAATGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-178s1c1
Sequence:CCGGGTTCACACAAAGATCTTCTTTCTCGAGAAAGAAGATCTTTGTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-504s1c1
Sequence:CCGGGAACAGGAAACACATTGAATTCTCGAGAATTCAATGTGTTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_173204
IL37 MISSION shRNA shRNA Plasmid DNA
interleukin 37
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-302s21c1
Sequence:CCGGGACAAAGTCATCCATCCCTTCCTCGAGGAAGGGATGGATGACTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-454s21c1
Sequence:CCGGTGCACCTCCTGCAATTGTAATCTCGAGATTACAATTGCAGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-229s21c1
Sequence:CCGGGCGGAGAAAGGAAGTCCGATTCTCGAGAATCGGACTTCCTTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-324s1c1
Sequence:CCGGGCTGAAGAAGGAGAAACTGATCTCGAGATCAGTTTCTCCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-280s1c1
Sequence:CCGGCTCTACTGTGACAAGGATAAACTCGAGTTTATCCTTGTCACAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-195s1c1
Sequence:CCGGCTTTGCATTAGCCTCATCCTTCTCGAGAAGGATGAGGCTAATGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-178s1c1
Sequence:CCGGGTTCACACAAAGATCTTCTTTCTCGAGAAAGAAGATCTTTGTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-504s1c1
Sequence:CCGGGAACAGGAAACACATTGAATTCTCGAGAATTCAATGTGTTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_173204
IL37 MISSION shRNA Lentiviral Transduction Particles
interleukin 37
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378801    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-302s21c1
Sequence:CCGGGACAAAGTCATCCATCCCTTCCTCGAGGAAGGGATGGATGACTTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372622    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-454s21c1
Sequence:CCGGTGCACCTCCTGCAATTGTAATCTCGAGATTACAATTGCAGGAGGTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372569    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_173204.1-229s21c1
Sequence:CCGGGCGGAGAAAGGAAGTCCGATTCTCGAGAATCGGACTTCCTTTCTCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058173    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-324s1c1
Sequence:CCGGGCTGAAGAAGGAGAAACTGATCTCGAGATCAGTTTCTCCTTCTTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058176    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-280s1c1
Sequence:CCGGCTCTACTGTGACAAGGATAAACTCGAGTTTATCCTTGTCACAGTAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058177    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-195s1c1
Sequence:CCGGCTTTGCATTAGCCTCATCCTTCTCGAGAAGGATGAGGCTAATGCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058175    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-178s1c1
Sequence:CCGGGTTCACACAAAGATCTTCTTTCTCGAGAAAGAAGATCTTTGTGTGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058174    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_173204.1-504s1c1
Sequence:CCGGGAACAGGAAACACATTGAATTCTCGAGAATTCAATGTGTTTCCTGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks