EMAIL THIS PAGE TO A FRIEND

IL5RA

interleukin 5 receptor, alpha

Synonyms: CD125 CDw125 HSIL5R3 IL5R
UniProtKB ID: Q01344, B4E2G0, Q14633, Q15469, Q6ISX9
Gene ID:
Human(3568) Summary: The protein encoded by this gene is an interleukin 5 specific subunit of a heterodimeric cytokine receptor. The receptor is comprised of a ligand specific alpha subunit and a signal transducing beta subunit shared by the receptors for interleukin 3 (IL3), colony stimulating factor 2 (CSF2/GM-CSF), and interleukin 5 (IL5). The binding of this protein to IL5 depends on the beta subunit. The beta subunit is activated by the ligand binding, and is required for the biological activities of IL5. This protein has been found to interact with syndecan binding protein (syntenin), which is required for IL5 mediated activation of the transcription factor SOX4. Several alternatively spliced transcript variants encoding four distinct isoforms have been reported. [provided by RefSeq, Jul 2011]
Mouse(16192) interleukin 5 receptor, alpha
Rat(114103) interleukin 5 receptor, alpha
chicken(771801) interleukin 5 receptor, alpha
domestic cat(101099031) interleukin 5 receptor, alpha
cow(615848) interleukin 5 receptor, alpha
dog(476553) interleukin 5 receptor, alpha
domestic guinea pig(100379257) interleukin 5 receptor, alpha
naked mole-rat(101701153) interleukin 5 receptor, alpha
sheep(101111837) interleukin 5 receptor, alpha
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000564 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000564 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000564 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_008370 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_008370 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_008370 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU083161 MISSION® esiRNA esiRNA human IL5RA (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000564 Rosetta Predictions human pricing
NM_175724 Rosetta Predictions human pricing
NM_175725 Rosetta Predictions human pricing
NM_175726 Rosetta Predictions human pricing
NM_175727 Rosetta Predictions human pricing
NM_175728 Rosetta Predictions human pricing
NM_053645 Rosetta Predictions rat pricing
NM_008370 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000564 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030520 predicted 992
2 SASI_Hs01_00030521 predicted 1373
3 SASI_Hs01_00030522 predicted 1195
4 SASI_Hs01_00030523 predicted 1297
5 SASI_Hs02_00302808 predicted 1335
6 SASI_Hs01_00030524 predicted 983
7 SASI_Hs01_00030525 predicted 1131
8 SASI_Hs01_00030527 predicted 1190
9 SASI_Hs01_00030528 predicted 867
10 SASI_Hs02_00302809 predicted 917
11 SASI_Hs01_00030519 predicted 1008
12 SASI_Hs01_00030526 predicted 1369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175724 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00092498 predicted 989
2 SASI_Hs01_00092499 predicted 1374
3 SASI_Hs01_00092500 predicted 1202
4 SASI_Hs01_00092501 predicted 1300
5 SASI_Hs02_00369054 predicted 1335
6 SASI_Hs01_00092502 predicted 983
7 SASI_Hs01_00092503 predicted 1131
8 SASI_Hs01_00092505 predicted 1195
9 SASI_Hs01_00092506 predicted 869
10 SASI_Hs02_00369055 predicted 918
11 SASI_Hs01_00092497 predicted 1001
12 SASI_Hs01_00092504 predicted 1372
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175725 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00237157 predicted 988
2 SASI_Hs01_00237158 predicted 1367
3 SASI_Hs01_00237159 predicted 1196
4 SASI_Hs01_00237160 predicted 1295
5 SASI_Hs02_00369056 predicted 1341
6 SASI_Hs01_00237161 predicted 986
7 SASI_Hs01_00237162 predicted 1136
8 SASI_Hs01_00237164 predicted 1198
9 SASI_Hs01_00237165 predicted 870
10 SASI_Hs02_00369057 predicted 914
11 SASI_Hs01_00237156 predicted 1007
12 SASI_Hs01_00237163 predicted 1370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175726 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159454 predicted 922
2 SASI_Hs01_00159455 predicted 1300
3 SASI_Hs01_00159456 predicted 1131
4 SASI_Hs01_00159457 predicted 1235
5 SASI_Hs02_00369058 predicted 1274
6 SASI_Hs01_00159458 predicted 917
7 SASI_Hs01_00159459 predicted 1068
8 SASI_Hs01_00159461 predicted 1122
9 SASI_Hs01_00159462 predicted 795
10 SASI_Hs02_00369059 predicted 850
11 SASI_Hs01_00159453 predicted 941
12 SASI_Hs01_00159460 predicted 1302
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175727 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00061986 predicted 915
2 SASI_Hs01_00061987 predicted 1306
3 SASI_Hs01_00061988 predicted 1133
4 SASI_Hs01_00061989 predicted 1235
5 SASI_Hs02_00369060 predicted 1271
6 SASI_Hs01_00061990 predicted 914
7 SASI_Hs01_00061991 predicted 1068
8 SASI_Hs01_00061993 predicted 1129
9 SASI_Hs01_00061994 predicted 802
10 SASI_Hs02_00369061 predicted 846
11 SASI_Hs01_00061985 predicted 941
12 SASI_Hs01_00061992 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175728 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00108562 predicted 919
2 SASI_Hs01_00108563 predicted 1300
3 SASI_Hs01_00108564 predicted 1126
4 SASI_Hs01_00108565 predicted 1229
5 SASI_Hs02_00369062 predicted 1271
6 SASI_Hs01_00108566 predicted 921
7 SASI_Hs01_00108567 predicted 1065
8 SASI_Hs01_00108569 predicted 1124
9 SASI_Hs01_00108570 predicted 798
10 SASI_Hs02_00369063 predicted 851
11 SASI_Hs01_00108561 predicted 939
12 SASI_Hs01_00108568 predicted 1304
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_053645 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00082526 predicted 497
2 SASI_Rn01_00082527 predicted 366
3 SASI_Rn01_00082528 predicted 674
4 SASI_Rn01_00082529 predicted 688
5 SASI_Rn01_00082530 predicted 733
6 SASI_Rn01_00082531 predicted 701
7 SASI_Rn01_00082532 predicted 646
8 SASI_Rn01_00082533 predicted 851
9 SASI_Rn01_00082534 predicted 601
10 SASI_Rn01_00082535 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_008370 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00313722 predicted 680
2 SASI_Mm02_00313723 predicted 1085
3 SASI_Mm02_00313724 predicted 877
4 SASI_Mm02_00313725 predicted 461
5 SASI_Mm02_00313726 predicted 1441
6 SASI_Mm02_00313727 predicted 952
7 SASI_Mm02_00313728 predicted 1047
8 SASI_Mm02_00313729 predicted 1383
9 SASI_Mm02_00313730 predicted 998
10 SASI_Mm02_00313731 predicted 469
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000564
IL5RA MISSION shRNA Bacterial Glycerol Stock
interleukin 5 receptor, alpha
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000372664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000564.3-1340s21c1
Sequence:CCGGCCTTCACGCCATTGATCAAATCTCGAGATTTGATCAATGGCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000564.3-2002s21c1
Sequence:CCGGATTTAGGCAACACTCAATTTACTCGAGTAAATTGAGTGTTGCCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000564.3-2243s21c1
Sequence:CCGGGCTAACGTCCAGCTGTATTTACTCGAGTAAATACAGCTGGACGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000564.2-2169s1c1
Sequence:CCGGGCTTGACTCACCTCAGACTTTCTCGAGAAAGTCTGAGGTGAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-1812s1c1
Sequence:CCGGCGGAAATTGAAGTCATCTGTTCTCGAGAACAGATGACTTCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-713s1c1
Sequence:CCGGCCTGTCAATTTCACCATTAAACTCGAGTTTAATGGTGAAATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-674s1c1
Sequence:CCGGGCTGACTTACTTCCTGATGAACTCGAGTTCATCAGGAAGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-1594s1c1
Sequence:CCGGCCAACCTATTTATGTGGGAAACTCGAGTTTCCCACATAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000564
IL5RA MISSION shRNA shRNA Plasmid DNA
interleukin 5 receptor, alpha
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000372664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000564.3-1340s21c1
Sequence:CCGGCCTTCACGCCATTGATCAAATCTCGAGATTTGATCAATGGCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000564.3-2002s21c1
Sequence:CCGGATTTAGGCAACACTCAATTTACTCGAGTAAATTGAGTGTTGCCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000564.3-2243s21c1
Sequence:CCGGGCTAACGTCCAGCTGTATTTACTCGAGTAAATACAGCTGGACGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000564.2-2169s1c1
Sequence:CCGGGCTTGACTCACCTCAGACTTTCTCGAGAAAGTCTGAGGTGAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-1812s1c1
Sequence:CCGGCGGAAATTGAAGTCATCTGTTCTCGAGAACAGATGACTTCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-713s1c1
Sequence:CCGGCCTGTCAATTTCACCATTAAACTCGAGTTTAATGGTGAAATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-674s1c1
Sequence:CCGGGCTGACTTACTTCCTGATGAACTCGAGTTCATCAGGAAGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-1594s1c1
Sequence:CCGGCCAACCTATTTATGTGGGAAACTCGAGTTTCCCACATAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000564
IL5RA MISSION shRNA Lentiviral Transduction Particles
interleukin 5 receptor, alpha
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000372664    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000564.3-1340s21c1
Sequence:CCGGCCTTCACGCCATTGATCAAATCTCGAGATTTGATCAATGGCGTGAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372666    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000564.3-2002s21c1
Sequence:CCGGATTTAGGCAACACTCAATTTACTCGAGTAAATTGAGTGTTGCCTAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372665    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000564.3-2243s21c1
Sequence:CCGGGCTAACGTCCAGCTGTATTTACTCGAGTAAATACAGCTGGACGTTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059118    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_000564.2-2169s1c1
Sequence:CCGGGCTTGACTCACCTCAGACTTTCTCGAGAAAGTCTGAGGTGAGTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059121    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-1812s1c1
Sequence:CCGGCGGAAATTGAAGTCATCTGTTCTCGAGAACAGATGACTTCAATTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059122    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-713s1c1
Sequence:CCGGCCTGTCAATTTCACCATTAAACTCGAGTTTAATGGTGAAATTGACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059120    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-674s1c1
Sequence:CCGGGCTGACTTACTTCCTGATGAACTCGAGTTCATCAGGAAGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059119    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000564.2-1594s1c1
Sequence:CCGGCCAACCTATTTATGTGGGAAACTCGAGTTTCCCACATAAATAGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_008370
IL5RA MISSION shRNA Bacterial Glycerol Stock
interleukin 5 receptor, alpha
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-676s1c1
Sequence:CCGGCGGTTACGAATTTAACTTGTACTCGAGTACAAGTTAAATTCGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-1163s1c1
Sequence:CCGGCGCCAATAAGTTCATCTCAAACTCGAGTTTGAGATGAACTTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-351s1c1
Sequence:CCGGGCTGACTTACTTAATCACAAACTCGAGTTTGTGATTAAGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-1275s1c1
Sequence:CCGGCCTATTTATGTGGGAAAGGAACTCGAGTTCCTTTCCCACATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-529s1c1
Sequence:CCGGCCAGAAAGACTGAAAGCAAATCTCGAGATTTGCTTTCAGTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_008370
IL5RA MISSION shRNA shRNA Plasmid DNA
interleukin 5 receptor, alpha
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-676s1c1
Sequence:CCGGCGGTTACGAATTTAACTTGTACTCGAGTACAAGTTAAATTCGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-1163s1c1
Sequence:CCGGCGCCAATAAGTTCATCTCAAACTCGAGTTTGAGATGAACTTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-351s1c1
Sequence:CCGGGCTGACTTACTTAATCACAAACTCGAGTTTGTGATTAAGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-1275s1c1
Sequence:CCGGCCTATTTATGTGGGAAAGGAACTCGAGTTCCTTTCCCACATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-529s1c1
Sequence:CCGGCCAGAAAGACTGAAAGCAAATCTCGAGATTTGCTTTCAGTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_008370
IL5RA MISSION shRNA Lentiviral Transduction Particles
interleukin 5 receptor, alpha
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068258    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-676s1c1
Sequence:CCGGCGGTTACGAATTTAACTTGTACTCGAGTACAAGTTAAATTCGTAACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068259    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-1163s1c1
Sequence:CCGGCGCCAATAAGTTCATCTCAAACTCGAGTTTGAGATGAACTTATTGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068262    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-351s1c1
Sequence:CCGGGCTGACTTACTTAATCACAAACTCGAGTTTGTGATTAAGTAAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068261    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-1275s1c1
Sequence:CCGGCCTATTTATGTGGGAAAGGAACTCGAGTTCCTTTCCCACATAAATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068260    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_008370.1-529s1c1
Sequence:CCGGCCAGAAAGACTGAAAGCAAATCTCGAGATTTGCTTTCAGTCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks