EMAIL THIS PAGE TO A FRIEND

IL6R

interleukin 6 receptor

Synonyms: CD126 IL-6R-1 IL-6RA IL6Q IL6RA IL6RQ gp80
Gene ID:
Human(3570) Summary: This gene encodes a subunit of the interleukin 6 (IL6) receptor complex. Interleukin 6 is a potent pleiotropic cytokine that regulates cell growth and differentiation and plays an important role in the immune response. The IL6 receptor is a protein complex consisting of this protein and interleukin 6 signal transducer (IL6ST/GP130/IL6-beta), a receptor subunit also shared by many other cytokines. Dysregulated production of IL6 and this receptor are implicated in the pathogenesis of many diseases, such as multiple myeloma, autoimmune diseases and prostate cancer. Alternatively spliced transcript variants encoding distinct isoforms have been reported. A pseudogene of this gene is found on chromosome 9.[provided by RefSeq, May 2011]
Rat(24499) interleukin 6 receptor
Zebrafish(100135755) interleukin 6 receptor
cow(507359) interleukin 6 receptor
domestic cat(101085689) interleukin 6 receptor
dog(612271) interleukin 6 receptor
domestic guinea pig(100730490) interleukin 6 receptor
naked mole-rat(101704925) interleukin 6 receptor
sheep(101103369) interleukin 6 receptor
122 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_000565 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_000565 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_000565 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU140561 MISSION® esiRNA esiRNA human IL6R (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_000565 Rosetta Predictions human pricing
NM_181359 Rosetta Predictions human pricing
NM_017020 Rosetta Predictions rat pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_000565 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00147852 predicted 2319
2 SASI_Hs01_00147854 predicted 2122
3 SASI_Hs02_00302810 predicted 1020
4 SASI_Hs01_00147855 predicted 2012
5 SASI_Hs01_00147856 predicted 2102
6 SASI_Hs01_00147857 predicted 1204
7 SASI_Hs01_00147858 predicted 989
8 SASI_Hs01_00147859 predicted 2234
9 SASI_Hs01_00147860 predicted 697
10 SASI_Hs01_00147861 predicted 1153
11 SASI_Hs01_00147853 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_181359 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00034359 predicted 1000
2 SASI_Hs01_00034361 predicted 2022
3 SASI_Hs02_00370027 predicted 1020
4 SASI_Hs01_00034362 predicted 1921
5 SASI_Hs01_00034363 predicted 2005
6 SASI_Hs01_00034364 predicted 1204
7 SASI_Hs01_00034365 predicted 987
8 SASI_Hs01_00034366 predicted 700
9 SASI_Hs01_00034367 predicted 1155
10 SASI_Hs01_00034368 predicted 943
11 SASI_Hs01_00034360 predicted 985
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017020 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00035058 predicted 740
2 SASI_Rn01_00035059 predicted 1171
3 SASI_Rn01_00035061 predicted 825
4 SASI_Rn01_00035062 predicted 549
5 SASI_Rn01_00035063 predicted 746
6 SASI_Rn02_00261187 predicted 614
7 SASI_Rn01_00035064 predicted 215
8 SASI_Rn01_00035065 predicted 617
9 SASI_Rn02_00261188 predicted 780
10 SASI_Rn01_00035067 predicted 1028
11 SASI_Rn01_00035060 predicted 1225
12 SASI_Rn01_00035066 predicted 712
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_000565
IL6R MISSION shRNA Bacterial Glycerol Stock
interleukin 6 receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000378748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000565.2-1206s21c1
Sequence:CCGGTATCGGGCTGAACGGTCAAAGCTCGAGCTTTGACCGTTCAGCCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000565.2-1647s21c1
Sequence:CCGGATGCATCCGCCGTACTCTTTGCTCGAGCAAAGAGTACGGCGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000372728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000565.2-1867s21c1
Sequence:CCGGCTGGACCCTGTGGATGATAAACTCGAGTTTATCATCCACAGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1430s1c1
Sequence:CCGGGCAGGCACTTACTACTAATAACTCGAGTTATTAGTAGTAAGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-707s1c1
Sequence:CCGGCTCTGGAAACTATTCATGCTACTCGAGTAGCATGAATAGTTTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1572s1c1
Sequence:CCGGCTCCTCTGCATTGCCATTGTTCTCGAGAACAATGGCAATGCAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1800s1c1
Sequence:CCGGAGCCCTTATGACATCAGCAATCTCGAGATTGCTGATGTCATAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1160s1c1
Sequence:CCGGCCACTCCTGGAACTCATCTTTCTCGAGAAAGATGAGTTCCAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_000565
IL6R MISSION shRNA shRNA Plasmid DNA
interleukin 6 receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000378748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000565.2-1206s21c1
Sequence:CCGGTATCGGGCTGAACGGTCAAAGCTCGAGCTTTGACCGTTCAGCCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000565.2-1647s21c1
Sequence:CCGGATGCATCCGCCGTACTCTTTGCTCGAGCAAAGAGTACGGCGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000372728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000565.2-1867s21c1
Sequence:CCGGCTGGACCCTGTGGATGATAAACTCGAGTTTATCATCCACAGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1430s1c1
Sequence:CCGGGCAGGCACTTACTACTAATAACTCGAGTTATTAGTAGTAAGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-707s1c1
Sequence:CCGGCTCTGGAAACTATTCATGCTACTCGAGTAGCATGAATAGTTTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1572s1c1
Sequence:CCGGCTCCTCTGCATTGCCATTGTTCTCGAGAACAATGGCAATGCAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1800s1c1
Sequence:CCGGAGCCCTTATGACATCAGCAATCTCGAGATTGCTGATGTCATAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1160s1c1
Sequence:CCGGCCACTCCTGGAACTCATCTTTCTCGAGAAAGATGAGTTCCAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_000565
IL6R MISSION shRNA Lentiviral Transduction Particles
interleukin 6 receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000378748    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000565.2-1206s21c1
Sequence:CCGGTATCGGGCTGAACGGTCAAAGCTCGAGCTTTGACCGTTCAGCCCGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372671    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_000565.2-1647s21c1
Sequence:CCGGATGCATCCGCCGTACTCTTTGCTCGAGCAAAGAGTACGGCGGATGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000372728    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_000565.2-1867s21c1
Sequence:CCGGCTGGACCCTGTGGATGATAAACTCGAGTTTATCATCCACAGGGTCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1430s1c1
Sequence:CCGGGCAGGCACTTACTACTAATAACTCGAGTTATTAGTAGTAAGTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-707s1c1
Sequence:CCGGCTCTGGAAACTATTCATGCTACTCGAGTAGCATGAATAGTTTCCAGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1572s1c1
Sequence:CCGGCTCCTCTGCATTGCCATTGTTCTCGAGAACAATGGCAATGCAGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1800s1c1
Sequence:CCGGAGCCCTTATGACATCAGCAATCTCGAGATTGCTGATGTCATAAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_000565.2-1160s1c1
Sequence:CCGGCCACTCCTGGAACTCATCTTTCTCGAGAAAGATGAGTTCCAGGAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks