EMAIL THIS PAGE TO A FRIEND

IL6ST

interleukin 6 signal transducer (gp130, oncostatin M receptor)

Synonyms: CD130 CDW130 GP130 IL-6RB
UniProtKB ID: P40189, A0N0L4, Q5FC04, Q9UQ41
Gene ID:
Human(3572) Summary: The protein encoded by this gene is a signal transducer shared by many cytokines, including interleukin 6 (IL6), ciliary neurotrophic factor (CNTF), leukemia inhibitory factor (LIF), and oncostatin M (OSM). This protein functions as a part of the cytokine receptor complex. The activation of this protein is dependent upon the binding of cytokines to their receptors. vIL6, a protein related to IL6 and encoded by the Kaposi sarcoma-associated herpesvirus, can bypass the interleukin 6 receptor (IL6R) and directly activate this protein. Knockout studies in mice suggest that this gene plays a critical role in regulating myocyte apoptosis. Alternatively spliced transcript variants encoding distinct isoforms have been described. A related pseudogene has been identified on chromosome 17. [provided by RefSeq, Jul 2010]
Mouse(16195) interleukin 6 signal transducer
Rat(25205) interleukin 6 signal transducer
Zebrafish(100006778) interleukin 6 signal transducer
chicken(395684) interleukin 6 signal transducer (gp130, oncostatin M receptor)
dog(403545) interleukin 6 signal transducer (gp130, oncostatin M receptor)
Horse(100051700) interleukin 6 signal transducer (gp130, oncostatin M receptor)
cow(522155) interleukin 6 signal transducer (gp130, oncostatin M receptor)
domestic cat(101089832) interleukin 6 signal transducer (gp130, oncostatin M receptor)
sheep(101113174) interleukin 6 signal transducer (gp130, oncostatin M receptor)
Domestic Rabbit(100349330) interleukin 6 signal transducer (gp130, oncostatin M receptor)
naked mole-rat(101703833) interleukin 6 signal transducer (gp130, oncostatin M receptor)
133 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010560 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010560 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010560 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_002184 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_002184 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_002184 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_002184 siRNAs that have been validated in the lab human pricing
NM_175767 Rosetta Predictions human pricing
NM_001008725 Rosetta Predictions rat pricing
XM_579200 Rosetta Predictions rat pricing
NM_010560 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_002184 siRNAs that have been validated in the lab Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029580 validated 559
1 SASI_Hs01_00029578 validated 708
1 SASI_Hs01_00029579 validated 1648
2 SASI_Hs02_00333401 predicted 2521
3 SASI_Hs02_00333402 predicted 2804
4 SASI_Hs01_00029581 predicted 2022
5 SASI_Hs01_00029582 predicted 2304
6 SASI_Hs01_00029583 predicted 1686
7 SASI_Hs01_00029584 predicted 1611
8 SASI_Hs02_00333403 predicted 2812
9 SASI_Hs01_00029585 predicted 2000
10 SASI_Hs02_00333404 predicted 2319
11 SASI_Hs01_00029586 predicted 1939
12 SASI_Hs01_00029587 predicted 2209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175767 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00094998 predicted 955
2 SASI_Hs01_00094999 predicted 799
3 SASI_Hs01_00095000 predicted 708
4 SASI_Hs01_00095002 predicted 1534
5 SASI_Hs01_00095003 predicted 923
6 SASI_Hs01_00095005 predicted 749
7 SASI_Hs01_00095006 predicted 584
8 SASI_Hs01_00095007 predicted 480
9 SASI_Hs02_00369110 predicted 753
10 SASI_Hs02_00369111 predicted 517
11 SASI_Hs01_00095001 predicted 551
12 SASI_Hs01_00095004 predicted 924
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008725 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063881 predicted 841
2 SASI_Rn01_00063882 predicted 2604
3 SASI_Rn01_00063883 predicted 1371
4 SASI_Rn02_00199253 predicted 660
5 SASI_Rn01_00063884 predicted 1168
6 SASI_Rn02_00199254 predicted 952
7 SASI_Rn02_00199255 predicted 1227
8 SASI_Rn01_00063887 predicted 348
9 SASI_Rn01_00063888 predicted 206
10 SASI_Rn01_00063889 predicted 2416
11 SASI_Rn01_00063885 predicted 1705
12 SASI_Rn01_00063886 predicted 1830
13 SASI_Rn01_00063890 predicted 2709
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579200 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00129532 predicted 843
2 SASI_Rn01_00129533 predicted 2612
3 SASI_Rn01_00129534 predicted 1380
4 SASI_Rn01_00129535 predicted 1177
5 SASI_Rn01_00129536 predicted 1698
6 SASI_Rn01_00129537 predicted 1817
7 SASI_Rn01_00129538 predicted 357
8 SASI_Rn01_00129539 predicted 208
9 SASI_Rn01_00129540 predicted 2425
10 SASI_Rn01_00129541 predicted 2696
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010560 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00318832 predicted 1887
2 SASI_Mm01_00184423 predicted 1870
3 SASI_Mm01_00184424 predicted 1657
4 SASI_Mm01_00184425 predicted 624
5 SASI_Mm01_00184426 predicted 1110
6 SASI_Mm01_00184427 predicted 930
7 SASI_Mm01_00184428 predicted 361
8 SASI_Mm01_00184429 predicted 2894
9 SASI_Mm01_00184430 predicted 789
10 SASI_Mm01_00184431 predicted 2881
11 SASI_Mm01_00184432 predicted 2914
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010560
VALIDATED
IL6ST MISSION shRNA Bacterial Glycerol Stock
interleukin 6 signal transducer (gp130, oncostatin M receptor)
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000379304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-898s21c1
Sequence:CCGGCTCCTCAGAGTCTATCAATTTCTCGAGAAATTGATAGACTCTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010560.3-3274s21c1
Sequence:CCGGCAAAGTGTGTCTGAGTTTATACTCGAGTATAAACTCAGACACACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-1308s21c1
Sequence:CCGGATAGATCTGTACGGCTCATATCTCGAGATATGAGCCGTACAGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-1165s21c1
Sequence:CCGGGTTTAGGATCCGGTCCATTAACTCGAGTTAATGGACCGGATCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000375443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2701s21c1
Sequence:CCGGCTTGCCCAGGCAACCGTATTTCTCGAGAAATACGGTTGCCTGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000363988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2321s21c1
Sequence:CCGGATGTACTCGGACGGCAATTTCCTCGAGGAAATTGCCGTCCGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000351964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2185s21c1
Sequence:CCGGCGTCTTGTTCTGCTTTAACAACTCGAGTTGTTAAAGCAGAACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-800s1c1
Sequence:CCGGCCCACCTATTATGTCAACATTCTCGAGAATGTTGACATAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-617s1c1
Sequence:CCGGCCTCCAGATAAACCTACAAATCTCGAGATTTGTAGGTTTATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010560.2-1583s1c1
Sequence:CCGGCCCGTGAGCAAGTACATCTTACTCGAGTAAGATGTACTTGCTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-2146s1c1
Sequence:CCGGCGTCTTGTTCTGCTTTAACAACTCGAGTTGTTAAAGCAGAACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000065389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-2665s1c1
Sequence:CCGGGCCCAGGCAATCGTATTTCAACTCGAGTTGAAATACGATTGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010560
VALIDATED
IL6ST MISSION shRNA shRNA Plasmid DNA
interleukin 6 signal transducer (gp130, oncostatin M receptor)
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000379304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-898s21c1
Sequence:CCGGCTCCTCAGAGTCTATCAATTTCTCGAGAAATTGATAGACTCTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010560.3-3274s21c1
Sequence:CCGGCAAAGTGTGTCTGAGTTTATACTCGAGTATAAACTCAGACACACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-1308s21c1
Sequence:CCGGATAGATCTGTACGGCTCATATCTCGAGATATGAGCCGTACAGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-1165s21c1
Sequence:CCGGGTTTAGGATCCGGTCCATTAACTCGAGTTAATGGACCGGATCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000375443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2701s21c1
Sequence:CCGGCTTGCCCAGGCAACCGTATTTCTCGAGAAATACGGTTGCCTGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000363988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2321s21c1
Sequence:CCGGATGTACTCGGACGGCAATTTCCTCGAGGAAATTGCCGTCCGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000351964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2185s21c1
Sequence:CCGGCGTCTTGTTCTGCTTTAACAACTCGAGTTGTTAAAGCAGAACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-800s1c1
Sequence:CCGGCCCACCTATTATGTCAACATTCTCGAGAATGTTGACATAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-617s1c1
Sequence:CCGGCCTCCAGATAAACCTACAAATCTCGAGATTTGTAGGTTTATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010560.2-1583s1c1
Sequence:CCGGCCCGTGAGCAAGTACATCTTACTCGAGTAAGATGTACTTGCTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-2146s1c1
Sequence:CCGGCGTCTTGTTCTGCTTTAACAACTCGAGTTGTTAAAGCAGAACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000065389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-2665s1c1
Sequence:CCGGGCCCAGGCAATCGTATTTCAACTCGAGTTGAAATACGATTGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010560
VALIDATED
IL6ST MISSION shRNA Lentiviral Transduction Particles
interleukin 6 signal transducer (gp130, oncostatin M receptor)
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000379304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-898s21c1
Sequence:CCGGCTCCTCAGAGTCTATCAATTTCTCGAGAAATTGATAGACTCTGAGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_010560.3-3274s21c1
Sequence:CCGGCAAAGTGTGTCTGAGTTTATACTCGAGTATAAACTCAGACACACTTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348727    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-1308s21c1
Sequence:CCGGATAGATCTGTACGGCTCATATCTCGAGATATGAGCCGTACAGATCTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-1165s21c1
Sequence:CCGGGTTTAGGATCCGGTCCATTAACTCGAGTTAATGGACCGGATCCTAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000375443    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2701s21c1
Sequence:CCGGCTTGCCCAGGCAACCGTATTTCTCGAGAAATACGGTTGCCTGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000363988    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2321s21c1
Sequence:CCGGATGTACTCGGACGGCAATTTCCTCGAGGAAATTGCCGTCCGAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000351964    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010560.3-2185s21c1
Sequence:CCGGCGTCTTGTTCTGCTTTAACAACTCGAGTTGTTAAAGCAGAACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065388    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-800s1c1
Sequence:CCGGCCCACCTATTATGTCAACATTCTCGAGAATGTTGACATAATAGGTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065390    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-617s1c1
Sequence:CCGGCCTCCAGATAAACCTACAAATCTCGAGATTTGTAGGTTTATCTGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065391    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_010560.2-1583s1c1
Sequence:CCGGCCCGTGAGCAAGTACATCTTACTCGAGTAAGATGTACTTGCTCACGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065392    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-2146s1c1
Sequence:CCGGCGTCTTGTTCTGCTTTAACAACTCGAGTTGTTAAAGCAGAACAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000065389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010560.2-2665s1c1
Sequence:CCGGGCCCAGGCAATCGTATTTCAACTCGAGTTGAAATACGATTGCCTGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_002184
VALIDATED
IL6ST MISSION shRNA Bacterial Glycerol Stock
interleukin 6 signal transducer (gp130, oncostatin M receptor)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000289712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-2629s21c1
Sequence:CCGGCGGCCAGAAGATCTACAATTACTCGAGTAATTGTAGATCTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-1271s21c1
Sequence:CCGGCCCATACTCAAGGCTACAGAACTCGAGTTCTGTAGCCTTGAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000289773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-2726s21c1
Sequence:CCGGCCAGTCCAGATATTTCACATTCTCGAGAATGTGAAATATCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-3035s21c1
Sequence:CCGGACTTCAGCAGTACCTATAAAGCTCGAGCTTTATAGGTACTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000296316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-1681s21c1
Sequence:CCGGACCGTGCATCGCACCTATTTACTCGAGTAAATAGGTGCGATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-927s1c1
Sequence:CCGGGCCACATAATTTATCAGTGATCTCGAGATCACTGATAAATTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-2726s1c1
Sequence:CCGGCCAGTCCAGATATTTCACATTCTCGAGAATGTGAAATATCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-1271s1c1
Sequence:CCGGCCCATACTCAAGGCTACAGAACTCGAGTTCTGTAGCCTTGAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002184.2-748s1c1
Sequence:CCGGGCAACACACAAGTTTGCTGATCTCGAGATCAGCAAACTTGTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000058287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-2629s1c1
Sequence:CCGGCGGCCAGAAGATCTACAATTACTCGAGTAATTGTAGATCTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_002184
VALIDATED
IL6ST MISSION shRNA shRNA Plasmid DNA
interleukin 6 signal transducer (gp130, oncostatin M receptor)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000289712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-2629s21c1
Sequence:CCGGCGGCCAGAAGATCTACAATTACTCGAGTAATTGTAGATCTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-1271s21c1
Sequence:CCGGCCCATACTCAAGGCTACAGAACTCGAGTTCTGTAGCCTTGAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000289773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-2726s21c1
Sequence:CCGGCCAGTCCAGATATTTCACATTCTCGAGAATGTGAAATATCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-3035s21c1
Sequence:CCGGACTTCAGCAGTACCTATAAAGCTCGAGCTTTATAGGTACTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000296316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-1681s21c1
Sequence:CCGGACCGTGCATCGCACCTATTTACTCGAGTAAATAGGTGCGATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-927s1c1
Sequence:CCGGGCCACATAATTTATCAGTGATCTCGAGATCACTGATAAATTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-2726s1c1
Sequence:CCGGCCAGTCCAGATATTTCACATTCTCGAGAATGTGAAATATCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-1271s1c1
Sequence:CCGGCCCATACTCAAGGCTACAGAACTCGAGTTCTGTAGCCTTGAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002184.2-748s1c1
Sequence:CCGGGCAACACACAAGTTTGCTGATCTCGAGATCAGCAAACTTGTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000058287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-2629s1c1
Sequence:CCGGCGGCCAGAAGATCTACAATTACTCGAGTAATTGTAGATCTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_002184
VALIDATED
IL6ST MISSION shRNA Lentiviral Transduction Particles
interleukin 6 signal transducer (gp130, oncostatin M receptor)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000289712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-2629s21c1
Sequence:CCGGCGGCCAGAAGATCTACAATTACTCGAGTAATTGTAGATCTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289711    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-1271s21c1
Sequence:CCGGCCCATACTCAAGGCTACAGAACTCGAGTTCTGTAGCCTTGAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000289773    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-2726s21c1
Sequence:CCGGCCAGTCCAGATATTTCACATTCTCGAGAATGTGAAATATCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296317    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-3035s21c1
Sequence:CCGGACTTCAGCAGTACCTATAAAGCTCGAGCTTTATAGGTACTGCTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000296316    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_002184.2-1681s21c1
Sequence:CCGGACCGTGCATCGCACCTATTTACTCGAGTAAATAGGTGCGATGCACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058283    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-927s1c1
Sequence:CCGGGCCACATAATTTATCAGTGATCTCGAGATCACTGATAAATTATGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058284    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-2726s1c1
Sequence:CCGGCCAGTCCAGATATTTCACATTCTCGAGAATGTGAAATATCTGGACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058285    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-1271s1c1
Sequence:CCGGCCCATACTCAAGGCTACAGAACTCGAGTTCTGTAGCCTTGAGTATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058286    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_002184.2-748s1c1
Sequence:CCGGGCAACACACAAGTTTGCTGATCTCGAGATCAGCAAACTTGTGTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000058287    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 1 Clone ID:NM_002184.2-2629s1c1
Sequence:CCGGCGGCCAGAAGATCTACAATTACTCGAGTAATTGTAGATCTTCTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks