EMAIL THIS PAGE TO A FRIEND

ILF2

interleukin enhancer binding factor 2

Synonyms: NF45 PRO3063
Gene ID:
Human(3608) Summary: The protein encoded by this gene is the 45 kDa component of nuclear factor of activated T-cells (NFAT), a heterodimer of 45 kDa and 90 kDa proteins. NFAT is a transcription factor required for T-cell expression of the interleukin 2 gene. It also binds RNA and is an essential component for encapsidation and protein priming of hepatitis B viral polymerase. The complex has been shown to repair DNA breaks by nonhomologous end joining and can also negatively regulate the microRNA processing pathway. Alternative splicing results in multiple transcript variants. Related pseudogenes have been found on chromosomes 3 and 14. [provided by RefSeq, Jun 2012]
Mouse(67781) interleukin enhancer binding factor 2
Rat(310612) interleukin enhancer binding factor 2
Zebrafish(406517) interleukin enhancer binding factor 2
chicken(425709) interleukin enhancer binding factor 2, 45kDa
domestic cat(101080940) interleukin enhancer binding factor 2, 45kDa
Horse(100056483) interleukin enhancer binding factor 2, 45kDa
cow(539760) interleukin enhancer binding factor 2, 45kDa
dog(480139) interleukin enhancer binding factor 2, 45kDa
sheep(101106476) interleukin enhancer binding factor 2, 45kDa
domestic guinea pig(100728552) interleukin enhancer binding factor 2
naked mole-rat(101714995) interleukin enhancer binding factor 2
65 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406033 Anti-ILF2 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA007484 Anti-ILF2 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution rat, mouse, human
immunofluorescence, immunohistochemistry, western blot pricing
AV35731 Anti-ILF2 antibody produced in rabbit IgG fraction of antiserum canine, zebrafish, horse, bovine, mouse, guinea pig, rat, human, rabbit
immunohistochemistry, western blot pricing
WH0003608M1 Monoclonal Anti-ILF2 antibody produced in mouse clone 1E2, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004515 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004515 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004515 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026374 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026374 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026374 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004515 Rosetta Predictions human pricing
NM_001047886 Rosetta Predictions rat pricing
XM_227385 Rosetta Predictions rat pricing
NM_026374 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004515 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00234331 predicted 498
2 SASI_Hs01_00234332 predicted 343
3 SASI_Hs01_00234333 predicted 386
4 SASI_Hs01_00234336 predicted 350
5 SASI_Hs02_00337794 predicted 518
6 SASI_Hs02_00337795 predicted 744
7 SASI_Hs01_00234329 predicted 439
8 SASI_Hs01_00234330 predicted 647
9 SASI_Hs01_00234334 predicted 585
10 SASI_Hs01_00234335 predicted 555
11 SASI_Hs01_00234337 predicted 882
12 SASI_Hs01_00234338 predicted 867
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001047886 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00206497 predicted 364
2 SASI_Rn02_00206498 predicted 312
3 SASI_Rn02_00206499 predicted 802
4 SASI_Rn02_00206500 predicted 845
5 SASI_Rn02_00206501 predicted 336
6 SASI_Rn02_00206502 predicted 735
7 SASI_Rn02_00206503 predicted 357
8 SASI_Rn02_00206504 predicted 425
9 SASI_Rn02_00206505 predicted 1006
10 SASI_Rn02_00206506 predicted 1059
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_227385 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00190660 predicted 1285
2 SASI_Rn01_00190661 predicted 540
3 SASI_Rn01_00190662 predicted 1220
4 SASI_Rn01_00190663 predicted 925
5 SASI_Rn01_00190664 predicted 1114
6 SASI_Rn01_00190665 predicted 329
7 SASI_Rn01_00190666 predicted 587
8 SASI_Rn01_00190667 predicted 1377
9 SASI_Rn01_00190668 predicted 450
10 SASI_Rn01_00190669 predicted 1100
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026374 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00330103 predicted 533
2 SASI_Mm01_00067224 predicted 1268
3 SASI_Mm01_00067225 predicted 682
4 SASI_Mm01_00067226 predicted 511
5 SASI_Mm01_00067227 predicted 770
6 SASI_Mm01_00067228 predicted 1104
7 SASI_Mm01_00067229 predicted 258
8 SASI_Mm01_00067230 predicted 311
9 SASI_Mm01_00067231 predicted 450
10 SASI_Mm01_00067232 predicted 610
11 SASI_Mm01_00067233 predicted 520
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004515
VALIDATED
ILF2 MISSION shRNA Bacterial Glycerol Stock
interleukin enhancer binding factor 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000353627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-387s21c1
Sequence:CCGGTCGACAGGTGGGATCCTATAACTCGAGTTATAGGATCCCACCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-557s21c1
Sequence:CCGGCCAACGAAACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-1115s21c1
Sequence:CCGGCCTGGGATGGAGTGATAGTAACTCGAGTTACTATCACTCCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000329726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-1430s21c1
Sequence:CCGGCCCATTTGTGACCTATGCCATCTCGAGATGGCATAGGTCACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-1430s1c1
Sequence:CCGGCCCATTTGTGACCTATGCCATCTCGAGATGGCATAGGTCACAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004515.2-355s1c1
Sequence:CCGGCCAGGGACATTTGAAGTGCAACTCGAGTTGCACTTCAAATGTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-557s1c1
Sequence:CCGGCCAACGAAACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTTTCGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-155s1c1
Sequence:CCGGCCTTTGTACCACATATCCCATCTCGAGATGGGATATGTGGTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-1115s1c1
Sequence:CCGGCCTGGGATGGAGTGATAGTAACTCGAGTTACTATCACTCCATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004515
VALIDATED
ILF2 MISSION shRNA shRNA Plasmid DNA
interleukin enhancer binding factor 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000353627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-387s21c1
Sequence:CCGGTCGACAGGTGGGATCCTATAACTCGAGTTATAGGATCCCACCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-557s21c1
Sequence:CCGGCCAACGAAACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-1115s21c1
Sequence:CCGGCCTGGGATGGAGTGATAGTAACTCGAGTTACTATCACTCCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000329726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-1430s21c1
Sequence:CCGGCCCATTTGTGACCTATGCCATCTCGAGATGGCATAGGTCACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-1430s1c1
Sequence:CCGGCCCATTTGTGACCTATGCCATCTCGAGATGGCATAGGTCACAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004515.2-355s1c1
Sequence:CCGGCCAGGGACATTTGAAGTGCAACTCGAGTTGCACTTCAAATGTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-557s1c1
Sequence:CCGGCCAACGAAACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTTTCGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-155s1c1
Sequence:CCGGCCTTTGTACCACATATCCCATCTCGAGATGGGATATGTGGTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-1115s1c1
Sequence:CCGGCCTGGGATGGAGTGATAGTAACTCGAGTTACTATCACTCCATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004515
VALIDATED
ILF2 MISSION shRNA Lentiviral Transduction Particles
interleukin enhancer binding factor 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000353627    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-387s21c1
Sequence:CCGGTCGACAGGTGGGATCCTATAACTCGAGTTATAGGATCCCACCTGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329725    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-557s21c1
Sequence:CCGGCCAACGAAACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTTTCGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329784    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-1115s21c1
Sequence:CCGGCCTGGGATGGAGTGATAGTAACTCGAGTTACTATCACTCCATCCCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000329726    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 2 Clone ID:NM_004515.2-1430s21c1
Sequence:CCGGCCCATTTGTGACCTATGCCATCTCGAGATGGCATAGGTCACAAATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014553    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-1430s1c1
Sequence:CCGGCCCATTTGTGACCTATGCCATCTCGAGATGGCATAGGTCACAAATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014554    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004515.2-355s1c1
Sequence:CCGGCCAGGGACATTTGAAGTGCAACTCGAGTTGCACTTCAAATGTCCCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014556    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-557s1c1
Sequence:CCGGCCAACGAAACTGGCTTTGAAACTCGAGTTTCAAAGCCAGTTTCGTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-155s1c1
Sequence:CCGGCCTTTGTACCACATATCCCATCTCGAGATGGGATATGTGGTACAAAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A549
TRC Version: 1 Clone ID:NM_004515.2-1115s1c1
Sequence:CCGGCCTGGGATGGAGTGATAGTAACTCGAGTTACTATCACTCCATCCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026374
VALIDATED
ILF2 MISSION shRNA Bacterial Glycerol Stock
interleukin enhancer binding factor 2
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000304646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-400s21c1
Sequence:CCGGTGACCTGGTGGTAATACTAAACTCGAGTTTAGTATTACCACCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-250s21c1
Sequence:CCGGGCAGGCTTCCATCCTTTCTTTCTCGAGAAAGAAAGGATGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-1050s21c1
Sequence:CCGGGCTATCTTGCTTCTGAAATATCTCGAGATATTTCAGAAGCAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-346s21c1
Sequence:CCGGCCGGCAGGTAGGATCATATAACTCGAGTTATATGATCCTACCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026374.3-1424s21c1
Sequence:CCGGTGCCACACATTCCCAATATTTCTCGAGAAATATTGGGAATGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-666s1c1
Sequence:CCGGGCTGGTTTGAAGAGAACGCTTCTCGAGAAGCGTTCTCTTCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-511s1c1
Sequence:CCGGGCTGACTAATGAAACTGGCTTCTCGAGAAGCCAGTTTCATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026374.2-1050s1c1
Sequence:CCGGGCTATCTTGCTTCTGAAATATCTCGAGATATTTCAGAAGCAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026374.2-250s1c1
Sequence:CCGGGCAGGCTTCCATCCTTTCTTTCTCGAGAAAGAAAGGATGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000066747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-693s1c1
Sequence:CCGGCCACAGTTAAAGTTCTCATAACTCGAGTTATGAGAACTTTAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026374
VALIDATED
ILF2 MISSION shRNA shRNA Plasmid DNA
interleukin enhancer binding factor 2
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000304646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-400s21c1
Sequence:CCGGTGACCTGGTGGTAATACTAAACTCGAGTTTAGTATTACCACCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-250s21c1
Sequence:CCGGGCAGGCTTCCATCCTTTCTTTCTCGAGAAAGAAAGGATGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-1050s21c1
Sequence:CCGGGCTATCTTGCTTCTGAAATATCTCGAGATATTTCAGAAGCAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-346s21c1
Sequence:CCGGCCGGCAGGTAGGATCATATAACTCGAGTTATATGATCCTACCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026374.3-1424s21c1
Sequence:CCGGTGCCACACATTCCCAATATTTCTCGAGAAATATTGGGAATGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-666s1c1
Sequence:CCGGGCTGGTTTGAAGAGAACGCTTCTCGAGAAGCGTTCTCTTCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-511s1c1
Sequence:CCGGGCTGACTAATGAAACTGGCTTCTCGAGAAGCCAGTTTCATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026374.2-1050s1c1
Sequence:CCGGGCTATCTTGCTTCTGAAATATCTCGAGATATTTCAGAAGCAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026374.2-250s1c1
Sequence:CCGGGCAGGCTTCCATCCTTTCTTTCTCGAGAAAGAAAGGATGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000066747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-693s1c1
Sequence:CCGGCCACAGTTAAAGTTCTCATAACTCGAGTTATGAGAACTTTAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026374
VALIDATED
ILF2 MISSION shRNA Lentiviral Transduction Particles
interleukin enhancer binding factor 2
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000304646    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-400s21c1
Sequence:CCGGTGACCTGGTGGTAATACTAAACTCGAGTTTAGTATTACCACCAGGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302231    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-250s21c1
Sequence:CCGGGCAGGCTTCCATCCTTTCTTTCTCGAGAAAGAAAGGATGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302157    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-1050s21c1
Sequence:CCGGGCTATCTTGCTTCTGAAATATCTCGAGATATTTCAGAAGCAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026374.3-346s21c1
Sequence:CCGGCCGGCAGGTAGGATCATATAACTCGAGTTATATGATCCTACCTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304645    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_026374.3-1424s21c1
Sequence:CCGGTGCCACACATTCCCAATATTTCTCGAGAAATATTGGGAATGTGTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-666s1c1
Sequence:CCGGGCTGGTTTGAAGAGAACGCTTCTCGAGAAGCGTTCTCTTCAAACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-511s1c1
Sequence:CCGGGCTGACTAATGAAACTGGCTTCTCGAGAAGCCAGTTTCATTAGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066745    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026374.2-1050s1c1
Sequence:CCGGGCTATCTTGCTTCTGAAATATCTCGAGATATTTCAGAAGCAAGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066744    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026374.2-250s1c1
Sequence:CCGGGCAGGCTTCCATCCTTTCTTTCTCGAGAAAGAAAGGATGGAAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000066747    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026374.2-693s1c1
Sequence:CCGGCCACAGTTAAAGTTCTCATAACTCGAGTTATGAGAACTTTAACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks