EMAIL THIS PAGE TO A FRIEND

IMP4

IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)

Synonyms: BXDC4
UniProtKB ID: Q96G21
Gene ID:
Human(92856) Summary: IMP4 forms a ternary complex with IMP3 (MIM 612980) and MPP10 (MPHOSPHO10; MIM 605503) that interacts with U3 small nucleolar RNA (snoRNA), which is required for the early cleavage steps in pre-rRNA processing (Granneman et al., 2003 [PubMed 12655004]
Mouse(27993) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Rat(316317) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Zebrafish(436992) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
cow(513405) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
domestic cat(101080603) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
dog(477350) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
chicken(100857200) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Thale Cress(842682) small nucleolar ribonucleoprotein protein
domestic guinea pig(100730033) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
naked mole-rat(101705813) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
sheep(101104207) IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178601 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178601 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178601 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_033416 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033416 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033416 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_033416 Rosetta Predictions human pricing
NM_001009700 Rosetta Predictions rat pricing
NM_178601 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033416 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018214 predicted 661
2 SASI_Hs01_00018215 predicted 417
3 SASI_Hs01_00018216 predicted 706
4 SASI_Hs02_00361313 predicted 494
5 SASI_Hs01_00018217 predicted 218
6 SASI_Hs01_00018218 predicted 353
7 SASI_Hs01_00018219 predicted 676
8 SASI_Hs01_00018221 predicted 204
9 SASI_Hs01_00018222 predicted 255
10 SASI_Hs01_00018223 predicted 249
11 SASI_Hs01_00018220 predicted 740
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009700 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00047619 predicted 1070
2 SASI_Rn01_00047620 predicted 1306
3 SASI_Rn01_00047621 predicted 1084
4 SASI_Rn01_00047622 predicted 1273
5 SASI_Rn01_00047623 predicted 1381
6 SASI_Rn01_00047624 predicted 1325
7 SASI_Rn01_00047625 predicted 422
8 SASI_Rn01_00047626 predicted 697
9 SASI_Rn01_00047627 predicted 882
10 SASI_Rn02_00199759 predicted 684
11 SASI_Rn01_00047618 predicted 835
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178601 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00075997 predicted 984
2 SASI_Mm01_00075999 predicted 835
3 SASI_Mm02_00348940 predicted 1028
4 SASI_Mm01_00076000 predicted 1175
5 SASI_Mm01_00076001 predicted 805
6 SASI_Mm01_00076002 predicted 994
7 SASI_Mm01_00076004 predicted 1146
8 SASI_Mm01_00076006 predicted 332
9 SASI_Mm02_00348941 predicted 569
10 SASI_Mm02_00348942 predicted 289
11 SASI_Mm01_00075998 predicted 1396
12 SASI_Mm01_00076003 predicted 768
13 SASI_Mm01_00076005 predicted 1105
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178601
VALIDATED
IMP4 MISSION shRNA Bacterial Glycerol Stock
IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178601.3-1054s21c1
Sequence:CCGGGGAGACTGGAGGGATCTAAATCTCGAGATTTAGATCCCTCCAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-300s21c1
Sequence:CCGGCAGCCATGTAGATGATGAATACTCGAGTATTCATCATCTACATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-696s21c1
Sequence:CCGGGGACATCCTTCGTTACCTATTCTCGAGAATAGGTAACGAAGGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-562s21c1
Sequence:CCGGTTCGGTCCTACTGCCTATTTCCTCGAGGAAATAGGCAGTAGGACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-215s21c1
Sequence:CCGGAGCTGATTCCCACCGAGTTACCTCGAGGTAACTCGGTGGGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178601.2-687s1c1
Sequence:CCGGCAAACCAGGATGACTACATTTCTCGAGAAATGTAGTCATCCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178601.2-229s1c1
Sequence:CCGGCAGCCATGTAGATGATGAATACTCGAGTATTCATCATCTACATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178601
VALIDATED
IMP4 MISSION shRNA shRNA Plasmid DNA
IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178601.3-1054s21c1
Sequence:CCGGGGAGACTGGAGGGATCTAAATCTCGAGATTTAGATCCCTCCAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-300s21c1
Sequence:CCGGCAGCCATGTAGATGATGAATACTCGAGTATTCATCATCTACATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-696s21c1
Sequence:CCGGGGACATCCTTCGTTACCTATTCTCGAGAATAGGTAACGAAGGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-562s21c1
Sequence:CCGGTTCGGTCCTACTGCCTATTTCCTCGAGGAAATAGGCAGTAGGACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-215s21c1
Sequence:CCGGAGCTGATTCCCACCGAGTTACCTCGAGGTAACTCGGTGGGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178601.2-687s1c1
Sequence:CCGGCAAACCAGGATGACTACATTTCTCGAGAAATGTAGTCATCCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178601.2-229s1c1
Sequence:CCGGCAGCCATGTAGATGATGAATACTCGAGTATTCATCATCTACATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178601
VALIDATED
IMP4 MISSION shRNA Lentiviral Transduction Particles
IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257857    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_178601.3-1054s21c1
Sequence:CCGGGGAGACTGGAGGGATCTAAATCTCGAGATTTAGATCCCTCCAGTCTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248953    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-300s21c1
Sequence:CCGGCAGCCATGTAGATGATGAATACTCGAGTATTCATCATCTACATGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.6 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-696s21c1
Sequence:CCGGGGACATCCTTCGTTACCTATTCTCGAGAATAGGTAACGAAGGATGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248954    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-562s21c1
Sequence:CCGGTTCGGTCCTACTGCCTATTTCCTCGAGGAAATAGGCAGTAGGACCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_178601.3-215s21c1
Sequence:CCGGAGCTGATTCCCACCGAGTTACCTCGAGGTAACTCGGTGGGAATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178601.2-687s1c1
Sequence:CCGGCAAACCAGGATGACTACATTTCTCGAGAAATGTAGTCATCCTGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176398    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178601.2-229s1c1
Sequence:CCGGCAGCCATGTAGATGATGAATACTCGAGTATTCATCATCTACATGGCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033416
VALIDATED
IMP4 MISSION shRNA Bacterial Glycerol Stock
IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000232767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-221s21c1
Sequence:CCGGCAGCCACGTGGATGATGAATACTCGAGTATTCATCATCCACGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-298s21c1
Sequence:CCGGGTTCCCGCCTCAAGATGTTTGCTCGAGCAAACATCTTGAGGCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-900s21c1
Sequence:CCGGTCACCACTCAGTCAGGACATGCTCGAGCATGTCCTGACTGAGTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033416.1-700s21c1
Sequence:CCGGCATTCCGGCACCATGTGTATACTCGAGTATACACATGGTGCCGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000232768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-255s21c1
Sequence:CCGGGTCGAGGATCCCAAGGTTATGCTCGAGCATAACCTTGGGATCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-678s1c1
Sequence:CCGGGCAAACCAGGACGACTACATACTCGAGTATGTAGTCGTCCTGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033416.1-704s1c1
Sequence:CCGGCCGGCACCATGTGTATAAGAACTCGAGTTCTTATACACATGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-482s1c1
Sequence:CCGGCTTTGGTCCTACTGCCTACTTCTCGAGAAGTAGGCAGTAGGACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033416.1-302s1c1
Sequence:CCGGCCGCCTCAAGATGTTTGCAAACTCGAGTTTGCAAACATCTTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-135s1c1
Sequence:CCGGCGCCTGATTCCCACTGAGTTACTCGAGTAACTCAGTGGGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033416
VALIDATED
IMP4 MISSION shRNA shRNA Plasmid DNA
IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000232767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-221s21c1
Sequence:CCGGCAGCCACGTGGATGATGAATACTCGAGTATTCATCATCCACGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-298s21c1
Sequence:CCGGGTTCCCGCCTCAAGATGTTTGCTCGAGCAAACATCTTGAGGCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-900s21c1
Sequence:CCGGTCACCACTCAGTCAGGACATGCTCGAGCATGTCCTGACTGAGTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033416.1-700s21c1
Sequence:CCGGCATTCCGGCACCATGTGTATACTCGAGTATACACATGGTGCCGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000232768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-255s21c1
Sequence:CCGGGTCGAGGATCCCAAGGTTATGCTCGAGCATAACCTTGGGATCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-678s1c1
Sequence:CCGGGCAAACCAGGACGACTACATACTCGAGTATGTAGTCGTCCTGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033416.1-704s1c1
Sequence:CCGGCCGGCACCATGTGTATAAGAACTCGAGTTCTTATACACATGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-482s1c1
Sequence:CCGGCTTTGGTCCTACTGCCTACTTCTCGAGAAGTAGGCAGTAGGACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033416.1-302s1c1
Sequence:CCGGCCGCCTCAAGATGTTTGCAAACTCGAGTTTGCAAACATCTTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-135s1c1
Sequence:CCGGCGCCTGATTCCCACTGAGTTACTCGAGTAACTCAGTGGGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033416
VALIDATED
IMP4 MISSION shRNA Lentiviral Transduction Particles
IMP4, U3 small nucleolar ribonucleoprotein, homolog (yeast)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000232767    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-221s21c1
Sequence:CCGGCAGCCACGTGGATGATGAATACTCGAGTATTCATCATCCACGTGGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232769    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-298s21c1
Sequence:CCGGGTTCCCGCCTCAAGATGTTTGCTCGAGCAAACATCTTGAGGCGGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232771    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-900s21c1
Sequence:CCGGTCACCACTCAGTCAGGACATGCTCGAGCATGTCCTGACTGAGTGGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232770    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033416.1-700s21c1
Sequence:CCGGCATTCCGGCACCATGTGTATACTCGAGTATACACATGGTGCCGGAATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000232768    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_033416.1-255s21c1
Sequence:CCGGGTCGAGGATCCCAAGGTTATGCTCGAGCATAACCTTGGGATCCTCGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062188    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-678s1c1
Sequence:CCGGGCAAACCAGGACGACTACATACTCGAGTATGTAGTCGTCCTGGTTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033416.1-704s1c1
Sequence:CCGGCCGGCACCATGTGTATAAGAACTCGAGTTCTTATACACATGGTGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-482s1c1
Sequence:CCGGCTTTGGTCCTACTGCCTACTTCTCGAGAAGTAGGCAGTAGGACCAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033416.1-302s1c1
Sequence:CCGGCCGCCTCAAGATGTTTGCAAACTCGAGTTTGCAAACATCTTGAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_033416.1-135s1c1
Sequence:CCGGCGCCTGATTCCCACTGAGTTACTCGAGTAACTCAGTGGGAATCAGGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks