EMAIL THIS PAGE TO A FRIEND

IMPAD1

inositol monophosphatase domain containing 1

Synonyms: GPAPP IMP 3 IMP-3 IMPA3
UniProtKB ID: Q9NX62, Q6NVY7
Gene ID:
Human(54928) Summary: This gene encodes a member of the inositol monophosphatase family. The encoded protein is localized to the Golgi apparatus and catalyzes the hydrolysis of phosphoadenosine phosphate (PAP) to adenosine monophosphate (AMP). Mutations in this gene are a cause of GRAPP type chondrodysplasia with joint dislocations, and a pseudogene of this gene is located on the long arm of chromosome 1. [provided by RefSeq, Dec 2011]
Mouse(242291) inositol monophosphatase domain containing 1
Rat(312952) inositol monophosphatase domain containing 1
Zebrafish(641570) inositol monophosphatase domain containing 1
dog(477890) inositol monophosphatase domain containing 1
domestic cat(101098356) inositol monophosphatase domain containing 1
cow(532797) inositol monophosphatase domain containing 1
chicken(421132) inositol monophosphatase domain containing 1
domestic guinea pig(100715393) inositol monophosphatase domain containing 1
naked mole-rat(101722322) inositol monophosphatase domain containing 1
sheep(101109546) inositol monophosphatase domain containing 1
Domestic Rabbit(100343037) inositol monophosphatase domain containing 1
129 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_017813 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_017813 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_017813 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177730 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177730 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177730 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_017813 Rosetta Predictions human pricing
XM_001069864 Rosetta Predictions rat pricing
XM_575759 Rosetta Predictions rat pricing
NM_177730 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_017813 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00159583 predicted 879
2 SASI_Hs01_00159584 predicted 895
3 SASI_Hs01_00159585 predicted 694
4 SASI_Hs01_00159586 predicted 832
5 SASI_Hs01_00159587 predicted 1171
6 SASI_Hs01_00159588 predicted 918
7 SASI_Hs01_00159590 predicted 778
8 SASI_Hs01_00159591 predicted 815
9 SASI_Hs01_00159592 predicted 701
10 SASI_Hs02_00350677 predicted 803
11 SASI_Hs01_00159589 predicted 823
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001069864 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00329637 predicted 822
2 SASI_Rn02_00329638 predicted 761
3 SASI_Rn02_00329639 predicted 796
4 SASI_Rn02_00329640 predicted 1101
5 SASI_Rn02_00329641 predicted 811
6 SASI_Rn02_00329642 predicted 1034
7 SASI_Rn02_00329643 predicted 1066
8 SASI_Rn02_00329644 predicted 924
9 SASI_Rn02_00329645 predicted 1272
10 SASI_Rn02_00329646 predicted 722
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_575759 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00404243 predicted 823
2 SASI_Rn02_00404244 predicted 764
3 SASI_Rn02_00404245 predicted 801
4 SASI_Rn02_00404246 predicted 1107
5 SASI_Rn02_00404247 predicted 808
6 SASI_Rn02_00404248 predicted 1033
7 SASI_Rn02_00404249 predicted 1071
8 SASI_Rn02_00404250 predicted 926
9 SASI_Rn02_00404251 predicted 1272
10 SASI_Rn02_00404252 predicted 718
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177730 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00171192 predicted 610
2 SASI_Mm01_00171193 predicted 451
3 SASI_Mm01_00171194 predicted 949
4 SASI_Mm01_00171195 predicted 748
5 SASI_Mm01_00171196 predicted 799
6 SASI_Mm01_00171197 predicted 876
7 SASI_Mm01_00171198 predicted 588
8 SASI_Mm01_00171199 predicted 801
9 SASI_Mm01_00171200 predicted 1055
10 SASI_Mm01_00171201 predicted 1019
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_017813
VALIDATED
IMPAD1 MISSION shRNA Bacterial Glycerol Stock
inositol monophosphatase domain containing 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000380068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1721s21c1
Sequence:GTACCGGGGTTGAAGGAAAGATTGATTTCTCGAGAAATCAATCTTTCCTTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1079s21c1
Sequence:CCGGGCTGGTGGTGCTGGTTATAAACTCGAGTTTATAACCAGCACCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-888s21c1
Sequence:CCGGCCATGCTAGGAGTTATACATACTCGAGTATGTATAACTCCTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-918s21c1
Sequence:CCGGCCGAATATACAGCTTGGGCAACTCGAGTTGCCCAAGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000292105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-967s21c1
Sequence:CCGGCCGCTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000303390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1598s21c1
Sequence:CCGGTCATACACAAGGCGCATATATCTCGAGATATATGCGCCTTGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-943s1c1
Sequence:CCGGCCGCTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-864s1c1
Sequence:CCGGCCATGCTAGGAGTTATACATACTCGAGTATGTATAACTCCTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-1164s1c1
Sequence:CCGGGTGCTGGTAATGCCATCTTAACTCGAGTTAAGATGGCATTACCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000051582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-683s1c1
Sequence:CCGGGAGGTTATCTTGTGGGATCATCTCGAGATGATCCCACAAGATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_017813
VALIDATED
IMPAD1 MISSION shRNA shRNA Plasmid DNA
inositol monophosphatase domain containing 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000380068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1721s21c1
Sequence:GTACCGGGGTTGAAGGAAAGATTGATTTCTCGAGAAATCAATCTTTCCTTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1079s21c1
Sequence:CCGGGCTGGTGGTGCTGGTTATAAACTCGAGTTTATAACCAGCACCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-888s21c1
Sequence:CCGGCCATGCTAGGAGTTATACATACTCGAGTATGTATAACTCCTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-918s21c1
Sequence:CCGGCCGAATATACAGCTTGGGCAACTCGAGTTGCCCAAGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000292105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-967s21c1
Sequence:CCGGCCGCTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000303390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1598s21c1
Sequence:CCGGTCATACACAAGGCGCATATATCTCGAGATATATGCGCCTTGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-943s1c1
Sequence:CCGGCCGCTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-864s1c1
Sequence:CCGGCCATGCTAGGAGTTATACATACTCGAGTATGTATAACTCCTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-1164s1c1
Sequence:CCGGGTGCTGGTAATGCCATCTTAACTCGAGTTAAGATGGCATTACCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000051582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-683s1c1
Sequence:CCGGGAGGTTATCTTGTGGGATCATCTCGAGATGATCCCACAAGATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_017813
VALIDATED
IMPAD1 MISSION shRNA Lentiviral Transduction Particles
inositol monophosphatase domain containing 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000380068    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1721s21c1
Sequence:GTACCGGGGTTGAAGGAAAGATTGATTTCTCGAGAAATCAATCTTTCCTTCAACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303330    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1079s21c1
Sequence:CCGGGCTGGTGGTGCTGGTTATAAACTCGAGTTTATAACCAGCACCACCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292106    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-888s21c1
Sequence:CCGGCCATGCTAGGAGTTATACATACTCGAGTATGTATAACTCCTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292042    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-918s21c1
Sequence:CCGGCCGAATATACAGCTTGGGCAACTCGAGTTGCCCAAGCTGTATATTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000292105    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_017813.3-967s21c1
Sequence:CCGGCCGCTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000303390    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 2 Clone ID:NM_017813.3-1598s21c1
Sequence:CCGGTCATACACAAGGCGCATATATCTCGAGATATATGCGCCTTGTGTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051579    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-943s1c1
Sequence:CCGGCCGCTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051580    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-864s1c1
Sequence:CCGGCCATGCTAGGAGTTATACATACTCGAGTATGTATAACTCCTAGCATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051581    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-1164s1c1
Sequence:CCGGGTGCTGGTAATGCCATCTTAACTCGAGTTAAGATGGCATTACCAGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000051582    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_017813.2-683s1c1
Sequence:CCGGGAGGTTATCTTGTGGGATCATCTCGAGATGATCCCACAAGATAACCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177730
VALIDATED
IMPAD1 MISSION shRNA Bacterial Glycerol Stock
inositol monophosphatase domain containing 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000215851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.3-1062s1c1
Sequence:CCGGCTATATATTCATGTGACATACCTCGAGGTATGTCACATGAATATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.3-1200s1c1
Sequence:CCGGCTTCTTGCTAGCATCAGAATGCTCGAGCATTCTGATGCTAGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-881s1c1
Sequence:CCGGCCGTTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000173584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-3858s1c1
Sequence:CCGGGCCTGGAATATGCTAGGGAATCTCGAGATTCCCTAGCATATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-2771s1c1
Sequence:CCGGCCCGTACTTAACAGTATGTAACTCGAGTTACATACTGTTAAGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-2927s1c1
Sequence:CCGGCCAGATAATATGACAGGAGAACTCGAGTTCTCCTGTCATATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000194089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.2-1029s1c1
Sequence:CCGGGATGTGCCTGATATGACTCAACTCGAGTTGAGTCATATCAGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000193411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.2-801s1c1
Sequence:CCGGCCTGTGTTAGGAGTTATTCATCTCGAGATGAATAACTCCTAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177730
VALIDATED
IMPAD1 MISSION shRNA shRNA Plasmid DNA
inositol monophosphatase domain containing 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000215851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.3-1062s1c1
Sequence:CCGGCTATATATTCATGTGACATACCTCGAGGTATGTCACATGAATATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.3-1200s1c1
Sequence:CCGGCTTCTTGCTAGCATCAGAATGCTCGAGCATTCTGATGCTAGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-881s1c1
Sequence:CCGGCCGTTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000173584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-3858s1c1
Sequence:CCGGGCCTGGAATATGCTAGGGAATCTCGAGATTCCCTAGCATATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-2771s1c1
Sequence:CCGGCCCGTACTTAACAGTATGTAACTCGAGTTACATACTGTTAAGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-2927s1c1
Sequence:CCGGCCAGATAATATGACAGGAGAACTCGAGTTCTCCTGTCATATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000194089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.2-1029s1c1
Sequence:CCGGGATGTGCCTGATATGACTCAACTCGAGTTGAGTCATATCAGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000193411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.2-801s1c1
Sequence:CCGGCCTGTGTTAGGAGTTATTCATCTCGAGATGAATAACTCCTAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177730
VALIDATED
IMPAD1 MISSION shRNA Lentiviral Transduction Particles
inositol monophosphatase domain containing 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000215851    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.3-1062s1c1
Sequence:CCGGCTATATATTCATGTGACATACCTCGAGGTATGTCACATGAATATATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217204    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.3-1200s1c1
Sequence:CCGGCTTCTTGCTAGCATCAGAATGCTCGAGCATTCTGATGCTAGCAAGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175469    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-881s1c1
Sequence:CCGGCCGTTCTTCCTACAATGAGAACTCGAGTTCTCATTGTAGGAAGAACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000173584    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-3858s1c1
Sequence:CCGGGCCTGGAATATGCTAGGGAATCTCGAGATTCCCTAGCATATTCCAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174471    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-2771s1c1
Sequence:CCGGCCCGTACTTAACAGTATGTAACTCGAGTTACATACTGTTAAGTACGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174472    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177730.2-2927s1c1
Sequence:CCGGCCAGATAATATGACAGGAGAACTCGAGTTCTCCTGTCATATTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000194089    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.2-1029s1c1
Sequence:CCGGGATGTGCCTGATATGACTCAACTCGAGTTGAGTCATATCAGGCACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000193411    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177730.2-801s1c1
Sequence:CCGGCCTGTGTTAGGAGTTATTCATCTCGAGATGAATAACTCCTAACACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks