EMAIL THIS PAGE TO A FRIEND

INADL

InaD-like (Drosophila)

Synonyms: Cipp InaD-like PATJ hINADL
Gene ID:
Human(10207) Summary: This gene encodes a protein with multiple PDZ domains. PDZ domains mediate protein-protein interactions, and proteins with multiple PDZ domains often organize multimeric complexes at the plasma membrane. This protein localizes to tight junctions and to the apical membrane of epithelial cells. A similar protein in Drosophila is a scaffolding protein which tethers several members of a multimeric signaling complex in photoreceptors. [provided by RefSeq, Jul 2008]
Mouse(12695) InaD-like (Drosophila)
Rat(140581) InaD-like (Drosophila)
Zebrafish(368723) InaD-like (Drosophila)
cow(536993) InaD-like (Drosophila)
Horse(100070486) InaD-like (Drosophila)
chicken(424682) InaD-like (Drosophila)
domestic cat(101098731) InaD-like (Drosophila)
dog(479550) InaD-like (Drosophila)
domestic guinea pig(100730516) InaD-like (Drosophila)
naked mole-rat(101719449) InaD-like (Drosophila)
sheep(101106044) InaD-like (Drosophila)
Domestic Rabbit(100356380) InaD-like (Drosophila)
275 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007704 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_007704 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_007704 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_176877 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_176877 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_176877 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_005799 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005799 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005799 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005799 Rosetta Predictions human pricing
NM_170605 Rosetta Predictions human pricing
NM_176877 Rosetta Predictions human pricing
NM_176878 Rosetta Predictions human pricing
NM_001005784 Rosetta Predictions mouse pricing
NM_001005787 Rosetta Predictions mouse pricing
NM_007704 Rosetta Predictions mouse pricing
NM_172696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005799 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00030089 predicted 2220
2 SASI_Hs01_00030090 predicted 2233
3 SASI_Hs01_00030091 predicted 1197
4 SASI_Hs01_00030092 predicted 2596
5 SASI_Hs01_00030093 predicted 1403
6 SASI_Hs01_00030094 predicted 3003
7 SASI_Hs01_00030095 predicted 1242
8 SASI_Hs01_00030096 predicted 3055
9 SASI_Hs01_00030097 predicted 314
10 SASI_Hs01_00030098 predicted 3337
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_170605 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00178435 predicted 2222
2 SASI_Hs01_00178436 predicted 2231
3 SASI_Hs01_00178437 predicted 1206
4 SASI_Hs01_00178438 predicted 2588
5 SASI_Hs01_00178439 predicted 1405
6 SASI_Hs01_00178440 predicted 3008
7 SASI_Hs01_00178441 predicted 1239
8 SASI_Hs01_00178442 predicted 3062
9 SASI_Hs01_00178443 predicted 305
10 SASI_Hs01_00178444 predicted 3340
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176877 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369260 predicted 4754
2 SASI_Hs01_00098797 predicted 2213
3 SASI_Hs01_00098798 predicted 2231
4 SASI_Hs01_00098801 predicted 1401
5 SASI_Hs02_00369261 predicted 789
6 SASI_Hs02_00369262 predicted 5364
7 SASI_Hs01_00098804 predicted 3049
8 SASI_Hs01_00098805 predicted 299
9 SASI_Hs02_00369263 predicted 5271
10 SASI_Hs01_00098806 predicted 3334
11 SASI_Hs01_00098799 predicted 1204
12 SASI_Hs01_00098800 predicted 3989
13 SASI_Hs01_00098802 predicted 3004
14 SASI_Hs01_00098803 predicted 4091
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176878 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00247344 predicted 2220
2 SASI_Hs01_00247345 predicted 2240
3 SASI_Hs01_00247346 predicted 1198
4 SASI_Hs01_00247347 predicted 3989
5 SASI_Hs01_00247348 predicted 1406
6 SASI_Hs01_00247349 predicted 3008
7 SASI_Hs01_00247350 predicted 4085
8 SASI_Hs01_00247351 predicted 3060
9 SASI_Hs01_00247352 predicted 306
10 SASI_Hs01_00247353 predicted 3339
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005784 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00099535 predicted 1190
2 SASI_Mm01_00099536 predicted 1341
3 SASI_Mm01_00099537 predicted 1391
4 SASI_Mm01_00099538 predicted 1260
5 SASI_Mm01_00099539 predicted 1617
6 SASI_Mm01_00099540 predicted 2573
7 SASI_Mm01_00099541 predicted 2745
8 SASI_Mm01_00099542 predicted 602
9 SASI_Mm01_00099543 predicted 1740
10 SASI_Mm01_00099544 predicted 1011
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001005787 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127257 predicted 572
2 SASI_Mm01_00127258 predicted 741
3 SASI_Mm01_00127259 predicted 1805
4 SASI_Mm01_00127260 predicted 1721
5 SASI_Mm02_00286652 predicted 1325
6 SASI_Mm01_00127264 predicted 1804
7 SASI_Mm02_00286653 predicted 576
8 SASI_Mm01_00127265 predicted 1798
9 SASI_Mm02_00286654 predicted 1150
10 SASI_Mm01_00127266 predicted 1347
11 SASI_Mm01_00127261 predicted 744
12 SASI_Mm01_00127262 predicted 1162
13 SASI_Mm01_00127263 predicted 1523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007704 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00147512 predicted 567
2 SASI_Mm01_00147513 predicted 742
3 SASI_Mm01_00147514 predicted 1797
4 SASI_Mm01_00147515 predicted 1721
5 SASI_Mm02_00312266 predicted 1331
6 SASI_Mm01_00147519 predicted 1810
7 SASI_Mm02_00312267 predicted 570
8 SASI_Mm01_00147520 predicted 1796
9 SASI_Mm02_00312268 predicted 1149
10 SASI_Mm01_00147521 predicted 1349
11 SASI_Mm01_00147516 predicted 747
12 SASI_Mm01_00147517 predicted 1160
13 SASI_Mm01_00147518 predicted 1529
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00172192 predicted 4187
2 SASI_Mm01_00172193 predicted 5251
3 SASI_Mm01_00172194 predicted 5167
4 SASI_Mm01_00172195 predicted 4190
5 SASI_Mm01_00172196 predicted 4621
6 SASI_Mm01_00172197 predicted 4777
7 SASI_Mm01_00172199 predicted 5254
8 SASI_Mm01_00172200 predicted 4020
9 SASI_Mm01_00172201 predicted 5245
10 SASI_Mm02_00344444 predicted 5251
11 SASI_Mm01_00172198 predicted 4973
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007704
INADL MISSION shRNA Bacterial Glycerol Stock
InaD-like (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000429907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007704.2-1954s21c1
Sequence:CCGGAGATCGGATTGTGAGCATTAACTCGAGTTAATGCTCACAATCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007704.2-2376s21c1
Sequence:CCGGGAACAGTTGCCTCGGCTAAAGCTCGAGCTTTAGCCGAGGCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007704.2-2538s21c1
Sequence:CCGGTGTCATCTTAACTCGTGATTTCTCGAGAAATCACGAGTTAAGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-971s1c1
Sequence:CCGGCCATTGTGTCAGTCAGCACATCTCGAGATGTGCTGACTGACACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-2009s1c1
Sequence:CCGGGCCGTTAATCTACTGAAGAATCTCGAGATTCTTCAGTAGATTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-400s1c1
Sequence:CCGGGCCGGGAGAACTACACATTATCTCGAGATAATGTGTAGTTCTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-1889s1c1
Sequence:CCGGCCCATATTTATTGCCATGATTCTCGAGAATCATGGCAATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007704.2-2617s1c1
Sequence:CCGGCCTCGCAATGAACTATTCATACTCGAGTATGAATAGTTCATTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007704
INADL MISSION shRNA shRNA Plasmid DNA
InaD-like (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000429907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007704.2-1954s21c1
Sequence:CCGGAGATCGGATTGTGAGCATTAACTCGAGTTAATGCTCACAATCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007704.2-2376s21c1
Sequence:CCGGGAACAGTTGCCTCGGCTAAAGCTCGAGCTTTAGCCGAGGCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007704.2-2538s21c1
Sequence:CCGGTGTCATCTTAACTCGTGATTTCTCGAGAAATCACGAGTTAAGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-971s1c1
Sequence:CCGGCCATTGTGTCAGTCAGCACATCTCGAGATGTGCTGACTGACACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-2009s1c1
Sequence:CCGGGCCGTTAATCTACTGAAGAATCTCGAGATTCTTCAGTAGATTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-400s1c1
Sequence:CCGGGCCGGGAGAACTACACATTATCTCGAGATAATGTGTAGTTCTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-1889s1c1
Sequence:CCGGCCCATATTTATTGCCATGATTCTCGAGAATCATGGCAATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007704.2-2617s1c1
Sequence:CCGGCCTCGCAATGAACTATTCATACTCGAGTATGAATAGTTCATTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007704
INADL MISSION shRNA Lentiviral Transduction Particles
InaD-like (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000429907    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007704.2-1954s21c1
Sequence:CCGGAGATCGGATTGTGAGCATTAACTCGAGTTAATGCTCACAATCCGATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417221    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007704.2-2376s21c1
Sequence:CCGGGAACAGTTGCCTCGGCTAAAGCTCGAGCTTTAGCCGAGGCAACTGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419720    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007704.2-2538s21c1
Sequence:CCGGTGTCATCTTAACTCGTGATTTCTCGAGAAATCACGAGTTAAGATGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124703    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-971s1c1
Sequence:CCGGCCATTGTGTCAGTCAGCACATCTCGAGATGTGCTGACTGACACAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124701    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-2009s1c1
Sequence:CCGGGCCGTTAATCTACTGAAGAATCTCGAGATTCTTCAGTAGATTAACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124702    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-400s1c1
Sequence:CCGGGCCGGGAGAACTACACATTATCTCGAGATAATGTGTAGTTCTCCCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124700    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007704.2-1889s1c1
Sequence:CCGGCCCATATTTATTGCCATGATTCTCGAGAATCATGGCAATAAATATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124699    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007704.2-2617s1c1
Sequence:CCGGCCTCGCAATGAACTATTCATACTCGAGTATGAATAGTTCATTGCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_176877
VALIDATED
INADL MISSION shRNA Bacterial Glycerol Stock
InaD-like (Drosophila)
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000236322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-5386s21c1
Sequence:CCGGGTTGTAGCAGATACCAATATACTCGAGTATATTGGTATCTGCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176877.2-8228s21c1
Sequence:CCGGCTCCGCTCACATGACTAATACCTCGAGGTATTAGTCATGTGAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-5501s21c1
Sequence:CCGGTGCAGATGACGGCCGATTAAACTCGAGTTTAATCGGCCGTCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-3889s21c1
Sequence:CCGGCGATCACGCATGAGCATATTTCTCGAGAAATATGCTCATGCGTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000236323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-4189s21c1
Sequence:CCGGAGCGTCGAAGTTGGTATTAAACTCGAGTTTAATACCAACTTCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_176877
VALIDATED
INADL MISSION shRNA shRNA Plasmid DNA
InaD-like (Drosophila)
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000236322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-5386s21c1
Sequence:CCGGGTTGTAGCAGATACCAATATACTCGAGTATATTGGTATCTGCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176877.2-8228s21c1
Sequence:CCGGCTCCGCTCACATGACTAATACCTCGAGGTATTAGTCATGTGAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-5501s21c1
Sequence:CCGGTGCAGATGACGGCCGATTAAACTCGAGTTTAATCGGCCGTCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-3889s21c1
Sequence:CCGGCGATCACGCATGAGCATATTTCTCGAGAAATATGCTCATGCGTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000236323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-4189s21c1
Sequence:CCGGAGCGTCGAAGTTGGTATTAAACTCGAGTTTAATACCAACTTCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_176877
VALIDATED
INADL MISSION shRNA Lentiviral Transduction Particles
InaD-like (Drosophila)
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000236322    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-5386s21c1
Sequence:CCGGGTTGTAGCAGATACCAATATACTCGAGTATATTGGTATCTGCTACAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236324    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_176877.2-8228s21c1
Sequence:CCGGCTCCGCTCACATGACTAATACCTCGAGGTATTAGTCATGTGAGCGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236326    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-5501s21c1
Sequence:CCGGTGCAGATGACGGCCGATTAAACTCGAGTTTAATCGGCCGTCATCTGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236325    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-3889s21c1
Sequence:CCGGCGATCACGCATGAGCATATTTCTCGAGAAATATGCTCATGCGTGATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000236323    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: A549
TRC Version: 2 Clone ID:NM_176877.2-4189s21c1
Sequence:CCGGAGCGTCGAAGTTGGTATTAAACTCGAGTTTAATACCAACTTCGACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005799
VALIDATED
INADL MISSION shRNA Bacterial Glycerol Stock
InaD-like (Drosophila)
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000162664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-417s1c1
Sequence:CCGGCTCGACTGTATCTGGGTTATTCTCGAGAATAACCCAGATACAGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-1723s1c1
Sequence:CCGGCCTGATTATGAAGTAATGGTTCTCGAGAACCATTACTTCATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000158824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-3144s1c1
Sequence:CCGGGCAAGAAGATTTGCCTTTATACTCGAGTATAAAGGCAAATCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005799.2-3619s1c1
Sequence:CCGGGTACATAACAAGGCCAACAAACTCGAGTTTGTTGGCCTTGTTATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000159811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-1576s1c1
Sequence:CCGGGAAACTAATGTGGATGGTGAACTCGAGTTCACCATCCACATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000160681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-3889s1c1
Sequence:CCGGCGATCACGCATGAGCATATTTCTCGAGAAATATGCTCATGCGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000161817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-3618s1c1
Sequence:CCGGCGTACATAACAAGGCCAACAACTCGAGTTGTTGGCCTTGTTATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005799
VALIDATED
INADL MISSION shRNA shRNA Plasmid DNA
InaD-like (Drosophila)
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000162664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-417s1c1
Sequence:CCGGCTCGACTGTATCTGGGTTATTCTCGAGAATAACCCAGATACAGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-1723s1c1
Sequence:CCGGCCTGATTATGAAGTAATGGTTCTCGAGAACCATTACTTCATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000158824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-3144s1c1
Sequence:CCGGGCAAGAAGATTTGCCTTTATACTCGAGTATAAAGGCAAATCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005799.2-3619s1c1
Sequence:CCGGGTACATAACAAGGCCAACAAACTCGAGTTTGTTGGCCTTGTTATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000159811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-1576s1c1
Sequence:CCGGGAAACTAATGTGGATGGTGAACTCGAGTTCACCATCCACATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000160681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-3889s1c1
Sequence:CCGGCGATCACGCATGAGCATATTTCTCGAGAAATATGCTCATGCGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000161817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-3618s1c1
Sequence:CCGGCGTACATAACAAGGCCAACAACTCGAGTTGTTGGCCTTGTTATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005799
VALIDATED
INADL MISSION shRNA Lentiviral Transduction Particles
InaD-like (Drosophila)
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000162664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-417s1c1
Sequence:CCGGCTCGACTGTATCTGGGTTATTCTCGAGAATAACCCAGATACAGTCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160184    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-1723s1c1
Sequence:CCGGCCTGATTATGAAGTAATGGTTCTCGAGAACCATTACTTCATAATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000158824    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-3144s1c1
Sequence:CCGGGCAAGAAGATTTGCCTTTATACTCGAGTATAAAGGCAAATCTTCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159109    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_005799.2-3619s1c1
Sequence:CCGGGTACATAACAAGGCCAACAAACTCGAGTTTGTTGGCCTTGTTATGTACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000159811    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_005799.2-1576s1c1
Sequence:CCGGGAAACTAATGTGGATGGTGAACTCGAGTTCACCATCCACATTAGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000160681    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-3889s1c1
Sequence:CCGGCGATCACGCATGAGCATATTTCTCGAGAAATATGCTCATGCGTGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000161817    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_005799.2-3618s1c1
Sequence:CCGGCGTACATAACAAGGCCAACAACTCGAGTTGTTGGCCTTGTTATGTACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks