EMAIL THIS PAGE TO A FRIEND

INO80C

INO80 complex subunit C

Synonyms: C18orf37 IES6 hIes6
UniProtKB ID: Q6PI98, B4DUI4, E9PCS7, Q86WR1, Q8N994
Gene ID:
Mouse(225280) INO80 complex subunit C
Rat(291737) INO80 complex subunit C
Zebrafish(791987) INO80 complex subunit C
dog(490484) INO80 complex subunit C
cow(533426) INO80 complex subunit C
domestic cat(101094214) INO80 complex subunit C
chicken(420956) INO80 complex subunit C
domestic guinea pig(100734736) INO80 complex subunit C
naked mole-rat(101709188) INO80 complex subunit C
Goat(100861330) INO80 complex subunit C
sheep(101110106) INO80 complex subunit C
84 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA049060 Anti-INO80C antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_194281 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_194281 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_194281 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172625 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172625 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172625 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001098817 Rosetta Predictions human pricing
NM_194281 Rosetta Predictions human pricing
NM_001017446 Rosetta Predictions rat pricing
NM_172625 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001098817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00320024 predicted 696
2 SASI_Hs02_00320025 predicted 632
3 SASI_Hs02_00320026 predicted 628
4 SASI_Hs02_00320027 predicted 630
5 SASI_Hs02_00320028 predicted 590
6 SASI_Hs02_00320029 predicted 635
7 SASI_Hs02_00320030 predicted 602
8 SASI_Hs02_00320031 predicted 691
9 SASI_Hs02_00320032 predicted 629
10 SASI_Hs02_00320033 predicted 605
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_194281 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00371398 predicted 586
2 SASI_Hs01_00029471 predicted 521
3 SASI_Hs01_00029473 predicted 512
4 SASI_Hs02_00371399 predicted 523
5 SASI_Hs01_00029477 predicted 484
6 SASI_Hs02_00371400 predicted 530
7 SASI_Hs02_00371401 predicted 492
8 SASI_Hs02_00371402 predicted 587
9 SASI_Hs02_00371403 predicted 512
10 SASI_Hs02_00371404 predicted 500
11 SASI_Hs01_00029468 predicted 284
12 SASI_Hs01_00029469 predicted 473
13 SASI_Hs01_00029470 predicted 283
14 SASI_Hs01_00029472 predicted 220
15 SASI_Hs01_00029474 predicted 484
16 SASI_Hs01_00029475 predicted 360
17 SASI_Hs01_00029476 predicted 369
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001017446 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00042409 predicted 200
2 SASI_Rn01_00042410 predicted 943
3 SASI_Rn01_00042411 predicted 262
4 SASI_Rn02_00202235 predicted 877
5 SASI_Rn01_00042413 predicted 910
6 SASI_Rn01_00042414 predicted 500
7 SASI_Rn01_00042415 predicted 721
8 SASI_Rn01_00042416 predicted 508
9 SASI_Rn01_00042417 predicted 854
10 SASI_Rn01_00042418 predicted 870
11 SASI_Rn01_00042412 predicted 626
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172625 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123763 predicted 772
2 SASI_Mm01_00123764 predicted 841
3 SASI_Mm01_00123765 predicted 713
4 SASI_Mm01_00123766 predicted 776
5 SASI_Mm01_00123767 predicted 422
6 SASI_Mm01_00123768 predicted 413
7 SASI_Mm01_00123769 predicted 382
8 SASI_Mm01_00123770 predicted 772
9 SASI_Mm01_00123771 predicted 421
10 SASI_Mm02_00344332 predicted 253
11 SASI_Mm01_00123762 predicted 428
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_194281
INO80C MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit C
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194281.3-737s21c1
Sequence:CCGGCAGACTCTGGACTCATGATTTCTCGAGAAATCATGAGTCCAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194281.2-765s1c1
Sequence:CCGGCGGAAACAAACTCGTTCTGCTCTCGAGAGCAGAACGAGTTTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194281.2-370s1c1
Sequence:CCGGGATCCCAACTTTGTGCACTCTCTCGAGAGAGTGCACAAAGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-486s1c1
Sequence:CCGGCGATCCTAACTACTTCAGTATCTCGAGATACTGAAGTAGTTAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194281.2-351s1c1
Sequence:CCGGCAAACCTTTGCCATTTAAGGACTCGAGTCCTTAAATGGCAAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-361s1c1
Sequence:CCGGCCATTTAAGGATCCCAACTTTCTCGAGAAAGTTGGGATCCTTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-286s1c1
Sequence:CCGGGAAGCCATGAGTGAGAATAAACTCGAGTTTATTCTCACTCATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194281.2-771s1c1
Sequence:CCGGCAAACTCGTTCTGCTGTCAATCTCGAGATTGACAGCAGAACGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_194281
INO80C MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit C
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194281.3-737s21c1
Sequence:CCGGCAGACTCTGGACTCATGATTTCTCGAGAAATCATGAGTCCAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194281.2-765s1c1
Sequence:CCGGCGGAAACAAACTCGTTCTGCTCTCGAGAGCAGAACGAGTTTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194281.2-370s1c1
Sequence:CCGGGATCCCAACTTTGTGCACTCTCTCGAGAGAGTGCACAAAGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-486s1c1
Sequence:CCGGCGATCCTAACTACTTCAGTATCTCGAGATACTGAAGTAGTTAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194281.2-351s1c1
Sequence:CCGGCAAACCTTTGCCATTTAAGGACTCGAGTCCTTAAATGGCAAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-361s1c1
Sequence:CCGGCCATTTAAGGATCCCAACTTTCTCGAGAAAGTTGGGATCCTTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-286s1c1
Sequence:CCGGGAAGCCATGAGTGAGAATAAACTCGAGTTTATTCTCACTCATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194281.2-771s1c1
Sequence:CCGGCAAACTCGTTCTGCTGTCAATCTCGAGATTGACAGCAGAACGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_194281
INO80C MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit C
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436125    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_194281.3-737s21c1
Sequence:CCGGCAGACTCTGGACTCATGATTTCTCGAGAAATCATGAGTCCAGAGTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138746    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194281.2-765s1c1
Sequence:CCGGCGGAAACAAACTCGTTCTGCTCTCGAGAGCAGAACGAGTTTGTTTCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137969    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194281.2-370s1c1
Sequence:CCGGGATCCCAACTTTGTGCACTCTCTCGAGAGAGTGCACAAAGTTGGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135766    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-486s1c1
Sequence:CCGGCGATCCTAACTACTTCAGTATCTCGAGATACTGAAGTAGTTAGGATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135098    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_194281.2-351s1c1
Sequence:CCGGCAAACCTTTGCCATTTAAGGACTCGAGTCCTTAAATGGCAAAGGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-361s1c1
Sequence:CCGGCCATTTAAGGATCCCAACTTTCTCGAGAAAGTTGGGATCCTTAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136035    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_194281.2-286s1c1
Sequence:CCGGGAAGCCATGAGTGAGAATAAACTCGAGTTTATTCTCACTCATGGCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136785    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_194281.2-771s1c1
Sequence:CCGGCAAACTCGTTCTGCTGTCAATCTCGAGATTGACAGCAGAACGAGTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172625
VALIDATED
INO80C MISSION shRNA Bacterial Glycerol Stock
INO80 complex subunit C
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000320273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172625.2-258s21c1
Sequence:CCGGGCCATTTAAGGATCCCAACTTCTCGAGAAGTTGGGATCCTTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172625.2-1472s21c1
Sequence:CCGGCCGGAATGTTAGAGATGCAATCTCGAGATTGCATCTCTAACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172625.2-1313s21c1
Sequence:CCGGGCAGGCAAACTCATACATATACTCGAGTATATGTATGAGTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172625.2-427s21c1
Sequence:CCGGCCAGCTAAGAAGTATTCTGATCTCGAGATCAGAATACTTCTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172625.1-1473s1c1
Sequence:CCGGCCGGAATGTTAGAGATGCAATCTCGAGATTGCATCTCTAACATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172625.1-1314s1c1
Sequence:CCGGGCAGGCAAACTCATACATATACTCGAGTATATGTATGAGTTTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172625.1-259s1c1
Sequence:CCGGGCCATTTAAGGATCCCAACTTCTCGAGAAGTTGGGATCCTTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172625.1-1558s1c1
Sequence:CCGGGCCCAATAAGAAGGAATACATCTCGAGATGTATTCCTTCTTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172625.1-428s1c1
Sequence:CCGGCCAGCTAAGAAGTATTCTGATCTCGAGATCAGAATACTTCTTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172625
VALIDATED
INO80C MISSION shRNA shRNA Plasmid DNA
INO80 complex subunit C
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000320273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172625.2-258s21c1
Sequence:CCGGGCCATTTAAGGATCCCAACTTCTCGAGAAGTTGGGATCCTTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172625.2-1472s21c1
Sequence:CCGGCCGGAATGTTAGAGATGCAATCTCGAGATTGCATCTCTAACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172625.2-1313s21c1
Sequence:CCGGGCAGGCAAACTCATACATATACTCGAGTATATGTATGAGTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172625.2-427s21c1
Sequence:CCGGCCAGCTAAGAAGTATTCTGATCTCGAGATCAGAATACTTCTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172625.1-1473s1c1
Sequence:CCGGCCGGAATGTTAGAGATGCAATCTCGAGATTGCATCTCTAACATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172625.1-1314s1c1
Sequence:CCGGGCAGGCAAACTCATACATATACTCGAGTATATGTATGAGTTTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172625.1-259s1c1
Sequence:CCGGGCCATTTAAGGATCCCAACTTCTCGAGAAGTTGGGATCCTTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172625.1-1558s1c1
Sequence:CCGGGCCCAATAAGAAGGAATACATCTCGAGATGTATTCCTTCTTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172625.1-428s1c1
Sequence:CCGGCCAGCTAAGAAGTATTCTGATCTCGAGATCAGAATACTTCTTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172625
VALIDATED
INO80C MISSION shRNA Lentiviral Transduction Particles
INO80 complex subunit C
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000320273    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172625.2-258s21c1
Sequence:CCGGGCCATTTAAGGATCCCAACTTCTCGAGAAGTTGGGATCCTTAAATGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320276    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172625.2-1472s21c1
Sequence:CCGGCCGGAATGTTAGAGATGCAATCTCGAGATTGCATCTCTAACATTCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320275    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_172625.2-1313s21c1
Sequence:CCGGGCAGGCAAACTCATACATATACTCGAGTATATGTATGAGTTTGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320347    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_172625.2-427s21c1
Sequence:CCGGCCAGCTAAGAAGTATTCTGATCTCGAGATCAGAATACTTCTTAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201638    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172625.1-1473s1c1
Sequence:CCGGCCGGAATGTTAGAGATGCAATCTCGAGATTGCATCTCTAACATTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192999    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172625.1-1314s1c1
Sequence:CCGGGCAGGCAAACTCATACATATACTCGAGTATATGTATGAGTTTGCCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190776    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172625.1-259s1c1
Sequence:CCGGGCCATTTAAGGATCCCAACTTCTCGAGAAGTTGGGATCCTTAAATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192678    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172625.1-1558s1c1
Sequence:CCGGGCCCAATAAGAAGGAATACATCTCGAGATGTATTCCTTCTTATTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200979    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172625.1-428s1c1
Sequence:CCGGCCAGCTAAGAAGTATTCTGATCTCGAGATCAGAATACTTCTTAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks